EMAIL THIS PAGE TO A FRIEND

LOC155060

31 Gene Product Result for
Species: Human LOC155060(155060)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004302 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004302 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004302 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU104251 MISSION® esiRNA esiRNA human ZNF783 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004302 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004302 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304493 predicted 2025
2 SASI_Hs02_00304494 predicted 2024
3 SASI_Hs02_00304495 predicted 2020
4 SASI_Hs01_00136108 predicted 256
5 SASI_Hs01_00136109 predicted 603
6 SASI_Hs02_00304496 predicted 976
7 SASI_Hs02_00304497 predicted 1916
8 SASI_Hs02_00304498 predicted 1944
9 SASI_Hs01_00136115 predicted 805
10 SASI_Hs01_00136116 predicted 728
11 SASI_Hs01_00136107 predicted 1276
12 SASI_Hs01_00136110 predicted 1440
13 SASI_Hs01_00136111 predicted 997
14 SASI_Hs01_00136112 predicted 1034
15 SASI_Hs01_00136113 predicted 1201
16 SASI_Hs01_00136114 predicted 983
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004302
LOC155060 MISSION shRNA Bacterial Glycerol Stock
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182951    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004302.1-2637s1c1
Sequence:CCGGCAGTGGTGAAATATAGTGATTCTCGAGAATCACTATATTTCACCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004302.1-526s1c1
Sequence:CCGGCAACAGGAACTTCTGGATCTTCTCGAGAAGATCCAGAAGTTCCTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004302.1-1384s1c1
Sequence:CCGGCTGCTTTATCTGTTGGATGTTCTCGAGAACATCCAACAGATAAAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004302.1-710s1c1
Sequence:CCGGGATTATGCAATCTCCAAACCACTCGAGTGGTTTGGAGATTGCATAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004302.2-265s21c2
Sequence:CCGGGTACCTCTACTCCACGGAAATCTCGAGATTTCCGTGGAGTAGAGGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004302.2-2846s21c2
Sequence:CCGGAGGATAGTCACATCCATTATTCTCGAGAATAATGGATGTGACTATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004302.2-1246s21c2
Sequence:GTACCGGGATCAATCTGACGATTCATCACTCGAGTGATGAATCGTCAGATTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004302.2-730s21c2
Sequence:CCGGAGACATCCTCACCCGGATAGACTCGAGTCTATCCGGGTGAGGATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004302
LOC155060 MISSION shRNA shRNA Plasmid DNA
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182951    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004302.1-2637s1c1
Sequence:CCGGCAGTGGTGAAATATAGTGATTCTCGAGAATCACTATATTTCACCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004302.1-526s1c1
Sequence:CCGGCAACAGGAACTTCTGGATCTTCTCGAGAAGATCCAGAAGTTCCTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004302.1-1384s1c1
Sequence:CCGGCTGCTTTATCTGTTGGATGTTCTCGAGAACATCCAACAGATAAAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004302.1-710s1c1
Sequence:CCGGGATTATGCAATCTCCAAACCACTCGAGTGGTTTGGAGATTGCATAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004302.2-265s21c2
Sequence:CCGGGTACCTCTACTCCACGGAAATCTCGAGATTTCCGTGGAGTAGAGGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004302.2-2846s21c2
Sequence:CCGGAGGATAGTCACATCCATTATTCTCGAGAATAATGGATGTGACTATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004302.2-1246s21c2
Sequence:GTACCGGGATCAATCTGACGATTCATCACTCGAGTGATGAATCGTCAGATTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004302.2-730s21c2
Sequence:CCGGAGACATCCTCACCCGGATAGACTCGAGTCTATCCGGGTGAGGATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004302
LOC155060 MISSION shRNA Lentiviral Transduction Particles
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182951    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004302.1-2637s1c1
Sequence:CCGGCAGTGGTGAAATATAGTGATTCTCGAGAATCACTATATTTCACCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004302.1-526s1c1
Sequence:CCGGCAACAGGAACTTCTGGATCTTCTCGAGAAGATCCAGAAGTTCCTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004302.1-1384s1c1
Sequence:CCGGCTGCTTTATCTGTTGGATGTTCTCGAGAACATCCAACAGATAAAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004302.1-710s1c1
Sequence:CCGGGATTATGCAATCTCCAAACCACTCGAGTGGTTTGGAGATTGCATAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004302.2-265s21c2
Sequence:CCGGGTACCTCTACTCCACGGAAATCTCGAGATTTCCGTGGAGTAGAGGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004302.2-2846s21c2
Sequence:CCGGAGGATAGTCACATCCATTATTCTCGAGAATAATGGATGTGACTATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004302.2-1246s21c2
Sequence:GTACCGGGATCAATCTGACGATTCATCACTCGAGTGATGAATCGTCAGATTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004302.2-730s21c2
Sequence:CCGGAGACATCCTCACCCGGATAGACTCGAGTCTATCCGGGTGAGGATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)