EMAIL THIS PAGE TO A FRIEND

LOC200726

22 Gene Product Result for
Species: Human LOC200726(200726)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001102659 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001102659 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001102659 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001102659 Rosetta Predictions human pricing
XM_117266 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102659 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323480 predicted 513
2 SASI_Hs02_00323481 predicted 233
3 SASI_Hs02_00323482 predicted 442
4 SASI_Hs02_00323483 predicted 290
5 SASI_Hs02_00323484 predicted 226
6 SASI_Hs02_00323485 predicted 521
7 SASI_Hs02_00323486 predicted 422
8 SASI_Hs02_00323487 predicted 475
9 SASI_Hs02_00323488 predicted 282
10 SASI_Hs02_00323489 predicted 360
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_117266 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00264979 predicted 239
2 SASI_Hs01_00264980 predicted 357
3 SASI_Hs01_00264981 predicted 286
4 SASI_Hs01_00264982 predicted 295
5 SASI_Hs01_00264983 predicted 290
6 SASI_Hs01_00264984 predicted 313
7 SASI_Hs01_00264985 predicted 303
8 SASI_Hs01_00264986 predicted 292
9 SASI_Hs01_00264987 predicted 252
10 SASI_Hs01_00264988 predicted 319
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001102659
LOC200726 MISSION shRNA Bacterial Glycerol Stock
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000271595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102659.1-575s21c1
Sequence:CCGGAGGAGTAAACAAGGTACATATCTCGAGATATGTACCTTGTTTACTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102659.1-719s21c1
Sequence:CCGGTAAATTGAACTCGGAGCTAATCTCGAGATTAGCTCCGAGTTCAATTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281812    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001102659.1-1174s21c1
Sequence:CCGGATCTTGTTTGACAGCATATTTCTCGAGAAATATGCTGTCAAACAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102659.1-364s21c1
Sequence:CCGGTCGCGTTTCCAACACTGTTTCCTCGAGGAAACAGTGTTGGAAACGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001102659
LOC200726 MISSION shRNA shRNA Plasmid DNA
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000271595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102659.1-575s21c1
Sequence:CCGGAGGAGTAAACAAGGTACATATCTCGAGATATGTACCTTGTTTACTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102659.1-719s21c1
Sequence:CCGGTAAATTGAACTCGGAGCTAATCTCGAGATTAGCTCCGAGTTCAATTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281812    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001102659.1-1174s21c1
Sequence:CCGGATCTTGTTTGACAGCATATTTCTCGAGAAATATGCTGTCAAACAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102659.1-364s21c1
Sequence:CCGGTCGCGTTTCCAACACTGTTTCCTCGAGGAAACAGTGTTGGAAACGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001102659
LOC200726 MISSION shRNA Lentiviral Transduction Particles
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000271595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102659.1-575s21c1
Sequence:CCGGAGGAGTAAACAAGGTACATATCTCGAGATATGTACCTTGTTTACTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102659.1-719s21c1
Sequence:CCGGTAAATTGAACTCGGAGCTAATCTCGAGATTAGCTCCGAGTTCAATTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281812    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001102659.1-1174s21c1
Sequence:CCGGATCTTGTTTGACAGCATATTTCTCGAGAAATATGCTGTCAAACAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102659.1-364s21c1
Sequence:CCGGTCGCGTTTCCAACACTGTTTCCTCGAGGAAACAGTGTTGGAAACGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)