EMAIL THIS PAGE TO A FRIEND

LOC201651

32 Gene Product Result for
Species: Human LOC201651(201651)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_114355 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_114355 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_114355 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_017321 Rosetta Predictions human pricing
XR_019163 Rosetta Predictions human pricing
XR_041981 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017321 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00492814 predicted 203
2 SASI_Hs02_00492815 predicted 301
3 SASI_Hs02_00492816 predicted 440
4 SASI_Hs02_00492817 predicted 1307
5 SASI_Hs02_00492818 predicted 358
6 SASI_Hs02_00492819 predicted 315
7 SASI_Hs02_00492820 predicted 480
8 SASI_Hs02_00492821 predicted 347
9 SASI_Hs02_00492822 predicted 1350
10 SASI_Hs02_00492823 predicted 941
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_019163 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00497457 predicted 199
2 SASI_Hs02_00497458 predicted 305
3 SASI_Hs02_00497459 predicted 437
4 SASI_Hs02_00497460 predicted 1307
5 SASI_Hs02_00497461 predicted 361
6 SASI_Hs02_00497462 predicted 318
7 SASI_Hs02_00497463 predicted 482
8 SASI_Hs02_00497464 predicted 347
9 SASI_Hs02_00497465 predicted 1358
10 SASI_Hs02_00497466 predicted 940
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041981 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00531992 predicted 202
2 SASI_Hs02_00531993 predicted 302
3 SASI_Hs02_00531994 predicted 437
4 SASI_Hs02_00531995 predicted 1304
5 SASI_Hs02_00531996 predicted 359
6 SASI_Hs02_00531997 predicted 315
7 SASI_Hs02_00531998 predicted 476
8 SASI_Hs02_00531999 predicted 339
9 SASI_Hs02_00532000 predicted 1352
10 SASI_Hs02_00532001 predicted 940
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_114355
LOC201651 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114355.1-312s1c1
Sequence:CCGGGCCAACACTAAAGTCAGAGATCTCGAGATCTCTGACTTTAGTGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114355.1-328s1c1
Sequence:CCGGGAGATACTAAGAACGGGCTTACTCGAGTAAGCCCGTTCTTAGTATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114355.1-201s1c1
Sequence:CCGGCATGAATACTGCAACGTTCTTCTCGAGAAGAACGTTGCAGTATTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114355.1-270s1c1
Sequence:CCGGGATAGAGACAACTTTCAGTAACTCGAGTTACTGAAAGTTGTCTCTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114355.1-385s1c1
Sequence:CCGGGCTGGTATGTGTTCCATATTACTCGAGTAATATGGAACACATACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_114355
LOC201651 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114355.1-312s1c1
Sequence:CCGGGCCAACACTAAAGTCAGAGATCTCGAGATCTCTGACTTTAGTGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114355.1-328s1c1
Sequence:CCGGGAGATACTAAGAACGGGCTTACTCGAGTAAGCCCGTTCTTAGTATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114355.1-201s1c1
Sequence:CCGGCATGAATACTGCAACGTTCTTCTCGAGAAGAACGTTGCAGTATTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114355.1-270s1c1
Sequence:CCGGGATAGAGACAACTTTCAGTAACTCGAGTTACTGAAAGTTGTCTCTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114355.1-385s1c1
Sequence:CCGGGCTGGTATGTGTTCCATATTACTCGAGTAATATGGAACACATACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_114355
LOC201651 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114355.1-312s1c1
Sequence:CCGGGCCAACACTAAAGTCAGAGATCTCGAGATCTCTGACTTTAGTGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114355.1-328s1c1
Sequence:CCGGGAGATACTAAGAACGGGCTTACTCGAGTAAGCCCGTTCTTAGTATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114355.1-201s1c1
Sequence:CCGGCATGAATACTGCAACGTTCTTCTCGAGAAGAACGTTGCAGTATTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114355.1-270s1c1
Sequence:CCGGGATAGAGACAACTTTCAGTAACTCGAGTTACTGAAAGTTGTCTCTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114355.1-385s1c1
Sequence:CCGGGCTGGTATGTGTTCCATATTACTCGAGTAATATGGAACACATACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)