EMAIL THIS PAGE TO A FRIEND

LOC202227

16 Gene Product Result for
Species: Human LOC202227(202227)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_116396 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_116396 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_116396 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_016767 Rosetta Predictions human pricing
XR_018309 Rosetta Predictions human pricing
XR_038864 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_016767 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00491618 predicted 316
2 SASI_Hs02_00491619 predicted 424
3 SASI_Hs02_00491620 predicted 389
4 SASI_Hs02_00491621 predicted 171
5 SASI_Hs02_00491622 predicted 186
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_018309 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00495820 predicted 309
2 SASI_Hs02_00495821 predicted 422
3 SASI_Hs02_00495822 predicted 383
4 SASI_Hs02_00495823 predicted 170
5 SASI_Hs02_00495824 predicted 185
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_038864 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00508226 predicted 313
2 SASI_Hs02_00508227 predicted 423
3 SASI_Hs02_00508228 predicted 390
4 SASI_Hs02_00508229 predicted 372
5 SASI_Hs02_00508230 predicted 174
6 SASI_Hs02_00508231 predicted 190
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_116396
LOC202227 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_116396.1-389s1c1
Sequence:CCGGGCAAGGCGAAAGAAGGCATAACTCGAGTTATGCCTTCTTTCGCCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_116396.1-256s1c1
Sequence:CCGGGAGAACTTCATTCTAAAGCATCTCGAGATGCTTTAGAATGAAGTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_116396.1-55s1c1
Sequence:CCGGCGCGTCTCCTTCAAGCTGTTTCTCGAGAAACAGCTTGAAGGAGACGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_116396.1-138s1c1
Sequence:CCGGTGGTTATAAGTGTTCTTGCCTCTCGAGAGGCAAGAACACTTATAACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_116396.1-146s1c1
Sequence:CCGGAGTGTTCTTGCCTTCACAGAACTCGAGTTCTGTGAAGGCAAGAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_116396
LOC202227 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_116396.1-389s1c1
Sequence:CCGGGCAAGGCGAAAGAAGGCATAACTCGAGTTATGCCTTCTTTCGCCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_116396.1-256s1c1
Sequence:CCGGGAGAACTTCATTCTAAAGCATCTCGAGATGCTTTAGAATGAAGTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_116396.1-55s1c1
Sequence:CCGGCGCGTCTCCTTCAAGCTGTTTCTCGAGAAACAGCTTGAAGGAGACGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_116396.1-138s1c1
Sequence:CCGGTGGTTATAAGTGTTCTTGCCTCTCGAGAGGCAAGAACACTTATAACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_116396.1-146s1c1
Sequence:CCGGAGTGTTCTTGCCTTCACAGAACTCGAGTTCTGTGAAGGCAAGAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_116396
LOC202227 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_116396.1-389s1c1
Sequence:CCGGGCAAGGCGAAAGAAGGCATAACTCGAGTTATGCCTTCTTTCGCCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_116396.1-256s1c1
Sequence:CCGGGAGAACTTCATTCTAAAGCATCTCGAGATGCTTTAGAATGAAGTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_116396.1-55s1c1
Sequence:CCGGCGCGTCTCCTTCAAGCTGTTTCTCGAGAAACAGCTTGAAGGAGACGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_116396.1-138s1c1
Sequence:CCGGTGGTTATAAGTGTTCTTGCCTCTCGAGAGGCAAGAACACTTATAACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_116396.1-146s1c1
Sequence:CCGGAGTGTTCTTGCCTTCACAGAACTCGAGTTCTGTGAAGGCAAGAACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)