EMAIL THIS PAGE TO A FRIEND

LOC256374

6 Gene Product Result for
Species: Human LOC256374(256374)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_170597 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_170597 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_170597 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001717840 Rosetta Predictions human pricing
XM_001717979 Rosetta Predictions human pricing
XM_170597 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717840 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00419871 predicted 412
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717979 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00420890 predicted 385
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_170597 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00478894 predicted 153
2 SASI_Hs02_00478895 predicted 388
3 SASI_Hs02_00478896 predicted 103
4 SASI_Hs02_00478897 predicted 52
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_170597
LOC256374 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_170597.2-356s1c1
Sequence:CCGGCAACACAAACAGTTCCCAGTTCTCGAGAACTGGGAACTGTTTGTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_170597.2-153s1c1
Sequence:CCGGGCTCTGAGCATTGGAGAGAAACTCGAGTTTCTCTCCAATGCTCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_170597.2-446s1c1
Sequence:CCGGCATGAATATTTGTGGAGGCCACTCGAGTGGCCTCCACAAATATTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_170597.2-95s1c1
Sequence:CCGGGTGTGTCTCCTTTGAGCCTTTCTCGAGAAAGGCTCAAAGGAGACACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_170597.2-269s1c1
Sequence:CCGGGTCCATCTACAGGGAGAAATTCTCGAGAATTTCTCCCTGTAGATGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_170597
LOC256374 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_170597.2-356s1c1
Sequence:CCGGCAACACAAACAGTTCCCAGTTCTCGAGAACTGGGAACTGTTTGTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_170597.2-153s1c1
Sequence:CCGGGCTCTGAGCATTGGAGAGAAACTCGAGTTTCTCTCCAATGCTCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_170597.2-446s1c1
Sequence:CCGGCATGAATATTTGTGGAGGCCACTCGAGTGGCCTCCACAAATATTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_170597.2-95s1c1
Sequence:CCGGGTGTGTCTCCTTTGAGCCTTTCTCGAGAAAGGCTCAAAGGAGACACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_170597.2-269s1c1
Sequence:CCGGGTCCATCTACAGGGAGAAATTCTCGAGAATTTCTCCCTGTAGATGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_170597
LOC256374 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_170597.2-356s1c1
Sequence:CCGGCAACACAAACAGTTCCCAGTTCTCGAGAACTGGGAACTGTTTGTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_170597.2-153s1c1
Sequence:CCGGGCTCTGAGCATTGGAGAGAAACTCGAGTTTCTCTCCAATGCTCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_170597.2-446s1c1
Sequence:CCGGCATGAATATTTGTGGAGGCCACTCGAGTGGCCTCCACAAATATTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_170597.2-95s1c1
Sequence:CCGGGTGTGTCTCCTTTGAGCCTTTCTCGAGAAAGGCTCAAAGGAGACACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_170597.2-269s1c1
Sequence:CCGGGTCCATCTACAGGGAGAAATTCTCGAGAATTTCTCCCTGTAGATGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)