EMAIL THIS PAGE TO A FRIEND

LOC257358

56 Gene Product Result for
Species: Human LOC257358(257358)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001025454 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001025454 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001025454 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025454 Rosetta Predictions human pricing
XR_017954 Rosetta Predictions human pricing
XR_040392 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025454 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053298 predicted 235
2 SASI_Hs01_00053299 predicted 240
3 SASI_Hs01_00053300 predicted 248
4 SASI_Hs01_00053301 predicted 250
5 SASI_Hs01_00053302 predicted 236
6 SASI_Hs01_00053303 predicted 244
7 SASI_Hs01_00053304 predicted 233
8 SASI_Hs01_00053305 predicted 196
9 SASI_Hs01_00053306 predicted 247
10 SASI_Hs01_00053307 predicted 214
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017954 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00495057 predicted 67
2 SASI_Hs02_00495058 predicted 213
3 SASI_Hs02_00495059 predicted 70
4 SASI_Hs02_00495060 predicted 15
5 SASI_Hs02_00495061 predicted 134
6 SASI_Hs02_00495062 predicted 209
7 SASI_Hs02_00495063 predicted 62
8 SASI_Hs02_00495064 predicted 137
9 SASI_Hs02_00495065 predicted 153
10 SASI_Hs02_00495066 predicted 139
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040392 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518461 predicted 65
2 SASI_Hs02_00518462 predicted 210
3 SASI_Hs02_00518463 predicted 66
4 SASI_Hs02_00518464 predicted 16
5 SASI_Hs02_00518465 predicted 131
6 SASI_Hs02_00518466 predicted 212
7 SASI_Hs02_00518467 predicted 65
8 SASI_Hs02_00518468 predicted 137
9 SASI_Hs02_00518469 predicted 149
10 SASI_Hs02_00518470 predicted 133
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025454
LOC257358 MISSION shRNA Bacterial Glycerol Stock
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025454.1-202s1c1
Sequence:CCGGCGTCTCAGAAAGATGCTTCCACTCGAGTGGAAGCATCTTTCTGAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025454.1-246s1c1
Sequence:CCGGGTGAGCTCGATAACCTGCAAACTCGAGTTTGCAGGTTATCGAGCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025454.1-262s1c1
Sequence:CCGGGCAAACCAGAGAAACCTGAGACTCGAGTCTCAGGTTTCTCTGGTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025454.1-305s1c1
Sequence:CCGGCAACGGAGACTTTATTGTGATCTCGAGATCACAATAAAGTCTCCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025454.1-166s1c1
Sequence:CCGGGCACCATGAATGTACAGTGGACTCGAGTCCACTGTACATTCATGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025454.1-209s1c1
Sequence:CCGGGAAAGATGCTTCCACTCACAACTCGAGTTGTGAGTGGAAGCATCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025454.1-163s1c1
Sequence:CCGGCCAGCACCATGAATGTACAGTCTCGAGACTGTACATTCATGGTGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025454.1-238s1c1
Sequence:CCGGGCTCACAAGTGAGCTCGATAACTCGAGTTATCGAGCTCACTTGTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025454.1-213s1c1
Sequence:CCGGGATGCTTCCACTCACAAGGATCTCGAGATCCTTGTGAGTGGAAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025454.1-308s1c1
Sequence:CCGGCGGAGACTTTATTGTGATTATCTCGAGATAATCACAATAAAGTCTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025454.1-254s1c1
Sequence:CCGGGATAACCTGCAAACCAGAGAACTCGAGTTCTCTGGTTTGCAGGTTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025454
LOC257358 MISSION shRNA shRNA Plasmid DNA
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025454.1-202s1c1
Sequence:CCGGCGTCTCAGAAAGATGCTTCCACTCGAGTGGAAGCATCTTTCTGAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025454.1-246s1c1
Sequence:CCGGGTGAGCTCGATAACCTGCAAACTCGAGTTTGCAGGTTATCGAGCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025454.1-262s1c1
Sequence:CCGGGCAAACCAGAGAAACCTGAGACTCGAGTCTCAGGTTTCTCTGGTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025454.1-305s1c1
Sequence:CCGGCAACGGAGACTTTATTGTGATCTCGAGATCACAATAAAGTCTCCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025454.1-166s1c1
Sequence:CCGGGCACCATGAATGTACAGTGGACTCGAGTCCACTGTACATTCATGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025454.1-209s1c1
Sequence:CCGGGAAAGATGCTTCCACTCACAACTCGAGTTGTGAGTGGAAGCATCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025454.1-163s1c1
Sequence:CCGGCCAGCACCATGAATGTACAGTCTCGAGACTGTACATTCATGGTGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025454.1-238s1c1
Sequence:CCGGGCTCACAAGTGAGCTCGATAACTCGAGTTATCGAGCTCACTTGTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025454.1-213s1c1
Sequence:CCGGGATGCTTCCACTCACAAGGATCTCGAGATCCTTGTGAGTGGAAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025454.1-308s1c1
Sequence:CCGGCGGAGACTTTATTGTGATTATCTCGAGATAATCACAATAAAGTCTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025454.1-254s1c1
Sequence:CCGGGATAACCTGCAAACCAGAGAACTCGAGTTCTCTGGTTTGCAGGTTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025454
LOC257358 MISSION shRNA Lentiviral Transduction Particles
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025454.1-202s1c1
Sequence:CCGGCGTCTCAGAAAGATGCTTCCACTCGAGTGGAAGCATCTTTCTGAGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025454.1-246s1c1
Sequence:CCGGGTGAGCTCGATAACCTGCAAACTCGAGTTTGCAGGTTATCGAGCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025454.1-262s1c1
Sequence:CCGGGCAAACCAGAGAAACCTGAGACTCGAGTCTCAGGTTTCTCTGGTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025454.1-305s1c1
Sequence:CCGGCAACGGAGACTTTATTGTGATCTCGAGATCACAATAAAGTCTCCGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025454.1-166s1c1
Sequence:CCGGGCACCATGAATGTACAGTGGACTCGAGTCCACTGTACATTCATGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025454.1-209s1c1
Sequence:CCGGGAAAGATGCTTCCACTCACAACTCGAGTTGTGAGTGGAAGCATCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025454.1-163s1c1
Sequence:CCGGCCAGCACCATGAATGTACAGTCTCGAGACTGTACATTCATGGTGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025454.1-238s1c1
Sequence:CCGGGCTCACAAGTGAGCTCGATAACTCGAGTTATCGAGCTCACTTGTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025454.1-213s1c1
Sequence:CCGGGATGCTTCCACTCACAAGGATCTCGAGATCCTTGTGAGTGGAAGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025454.1-308s1c1
Sequence:CCGGCGGAGACTTTATTGTGATTATCTCGAGATAATCACAATAAAGTCTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025454.1-254s1c1
Sequence:CCGGGATAACCTGCAAACCAGAGAACTCGAGTTCTCTGGTTTGCAGGTTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)