EMAIL THIS PAGE TO A FRIEND

LOC284009

14 Gene Product Result for
Species: Human LOC284009(284009)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV54457 Anti-LOC284009 antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_378642 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_378642 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_378642 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001025459 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001025459 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001025459 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025459 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025459 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084479 predicted 78
2 SASI_Hs01_00084480 predicted 381
3 SASI_Hs01_00084481 predicted 324
4 SASI_Hs01_00084482 predicted 315
5 SASI_Hs01_00084483 predicted 414
6 SASI_Hs01_00084484 predicted 349
7 SASI_Hs01_00084485 predicted 393
8 SASI_Hs01_00084487 predicted 478
9 SASI_Hs01_00084488 predicted 380
10 SASI_Hs02_00307462 predicted 85
11 SASI_Hs01_00084486 predicted 517
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_378642
LOC284009 MISSION shRNA Bacterial Glycerol Stock
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000204017    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_378642.1-2220s1c1
Sequence:CCGGGCGCTACTCAAATACCTCATACTCGAGTATGAGGTATTTGAGTAGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_378642.1-1145s1c1
Sequence:CCGGGAACTGCATTTCTTTCCTTATCTCGAGATAAGGAAAGAAATGCAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204425    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_378642.1-2039s1c1
Sequence:CCGGCCCAGCCTTAAATCCACTGAACTCGAGTTCAGTGGATTTAAGGCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_378642
LOC284009 MISSION shRNA shRNA Plasmid DNA
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000204017    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_378642.1-2220s1c1
Sequence:CCGGGCGCTACTCAAATACCTCATACTCGAGTATGAGGTATTTGAGTAGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_378642.1-1145s1c1
Sequence:CCGGGAACTGCATTTCTTTCCTTATCTCGAGATAAGGAAAGAAATGCAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204425    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_378642.1-2039s1c1
Sequence:CCGGCCCAGCCTTAAATCCACTGAACTCGAGTTCAGTGGATTTAAGGCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_378642
LOC284009 MISSION shRNA Lentiviral Transduction Particles
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000204017    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_378642.1-2220s1c1
Sequence:CCGGGCGCTACTCAAATACCTCATACTCGAGTATGAGGTATTTGAGTAGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_378642.1-1145s1c1
Sequence:CCGGGAACTGCATTTCTTTCCTTATCTCGAGATAAGGAAAGAAATGCAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204425    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_378642.1-2039s1c1
Sequence:CCGGCCCAGCCTTAAATCCACTGAACTCGAGTTCAGTGGATTTAAGGCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025459
LOC284009 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025459.2-268s21c1
Sequence:CCGGAGAGCACAGACTTCGACGTTCCTCGAGGAACGTCGAAGTCTGTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025459.2-326s21c1
Sequence:CCGGGGAATCCCTGACATCGTCATCCTCGAGGATGACGATGTCAGGGATTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025459.2-299s21c1
Sequence:CCGGTCCCGTCCAGTTCCATTCCTTCTCGAGAAGGAATGGAACTGGACGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025459.2-179s21c1
Sequence:CCGGTTCTGGTACAGGATCAGATGTCTCGAGACATCTGATCCTGTACCAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025459.2-212s21c1
Sequence:CCGGGTTGTGCACATAGGAGGAGAACTCGAGTTCTCCTCCTATGTGCACAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025459
LOC284009 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025459.2-268s21c1
Sequence:CCGGAGAGCACAGACTTCGACGTTCCTCGAGGAACGTCGAAGTCTGTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025459.2-326s21c1
Sequence:CCGGGGAATCCCTGACATCGTCATCCTCGAGGATGACGATGTCAGGGATTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025459.2-299s21c1
Sequence:CCGGTCCCGTCCAGTTCCATTCCTTCTCGAGAAGGAATGGAACTGGACGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025459.2-179s21c1
Sequence:CCGGTTCTGGTACAGGATCAGATGTCTCGAGACATCTGATCCTGTACCAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025459.2-212s21c1
Sequence:CCGGGTTGTGCACATAGGAGGAGAACTCGAGTTCTCCTCCTATGTGCACAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025459
LOC284009 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025459.2-268s21c1
Sequence:CCGGAGAGCACAGACTTCGACGTTCCTCGAGGAACGTCGAAGTCTGTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025459.2-326s21c1
Sequence:CCGGGGAATCCCTGACATCGTCATCCTCGAGGATGACGATGTCAGGGATTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025459.2-299s21c1
Sequence:CCGGTCCCGTCCAGTTCCATTCCTTCTCGAGAAGGAATGGAACTGGACGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025459.2-179s21c1
Sequence:CCGGTTCTGGTACAGGATCAGATGTCTCGAGACATCTGATCCTGTACCAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025459.2-212s21c1
Sequence:CCGGGTTGTGCACATAGGAGGAGAACTCGAGTTCTCCTCCTATGTGCACAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)