EMAIL THIS PAGE TO A FRIEND

LOC284581

Gene Product Result for
Species: Human LOC284581(284581)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010882
LOC284581 MISSION shRNA Bacterial Glycerol Stock
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010882.1-771s1c1
Sequence:CCGGCTTTGGCACCAAATGTGTCATCTCGAGATGACACATTTGGTGCCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143035    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010882.1-1002s1c1
Sequence:CCGGCCTTTGTTCCTTCCTCTCTTACTCGAGTAAGAGAGGAAGGAACAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142210    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010882.1-2666s1c1
Sequence:CCGGGCTCAGTTACAGGAGTCTCTTCTCGAGAAGAGACTCCTGTAACTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142276    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010882.1-881s1c1
Sequence:CCGGGAGAGTCAGCCCAGTCTATATCTCGAGATATAGACTGGGCTGACTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010882.1-779s1c1
Sequence:CCGGCCAAATGTGTCATGCATCCATCTCGAGATGGATGCATGACACATTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010882.1-1915s1c1
Sequence:CCGGGCAGGTTTATTTGCCAGCTAACTCGAGTTAGCTGGCAAATAAACCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010882.1-953s1c1
Sequence:CCGGGTGAGTACTTACATCTAGCATCTCGAGATGCTAGATGTAAGTACTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010882.1-2378s1c1
Sequence:CCGGCCTGCTTAGTTCTTACAATTTCTCGAGAAATTGTAAGAACTAAGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010882
LOC284581 MISSION shRNA shRNA Plasmid DNA
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010882.1-771s1c1
Sequence:CCGGCTTTGGCACCAAATGTGTCATCTCGAGATGACACATTTGGTGCCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143035    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010882.1-1002s1c1
Sequence:CCGGCCTTTGTTCCTTCCTCTCTTACTCGAGTAAGAGAGGAAGGAACAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142210    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010882.1-2666s1c1
Sequence:CCGGGCTCAGTTACAGGAGTCTCTTCTCGAGAAGAGACTCCTGTAACTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142276    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010882.1-881s1c1
Sequence:CCGGGAGAGTCAGCCCAGTCTATATCTCGAGATATAGACTGGGCTGACTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010882.1-779s1c1
Sequence:CCGGCCAAATGTGTCATGCATCCATCTCGAGATGGATGCATGACACATTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010882.1-1915s1c1
Sequence:CCGGGCAGGTTTATTTGCCAGCTAACTCGAGTTAGCTGGCAAATAAACCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010882.1-953s1c1
Sequence:CCGGGTGAGTACTTACATCTAGCATCTCGAGATGCTAGATGTAAGTACTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010882.1-2378s1c1
Sequence:CCGGCCTGCTTAGTTCTTACAATTTCTCGAGAAATTGTAAGAACTAAGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010882
LOC284581 MISSION shRNA Lentiviral Transduction Particles
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010882.1-771s1c1
Sequence:CCGGCTTTGGCACCAAATGTGTCATCTCGAGATGACACATTTGGTGCCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143035    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010882.1-1002s1c1
Sequence:CCGGCCTTTGTTCCTTCCTCTCTTACTCGAGTAAGAGAGGAAGGAACAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142210    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010882.1-2666s1c1
Sequence:CCGGGCTCAGTTACAGGAGTCTCTTCTCGAGAAGAGACTCCTGTAACTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142276    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010882.1-881s1c1
Sequence:CCGGGAGAGTCAGCCCAGTCTATATCTCGAGATATAGACTGGGCTGACTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010882.1-779s1c1
Sequence:CCGGCCAAATGTGTCATGCATCCATCTCGAGATGGATGCATGACACATTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010882.1-1915s1c1
Sequence:CCGGGCAGGTTTATTTGCCAGCTAACTCGAGTTAGCTGGCAAATAAACCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001010882.1-953s1c1
Sequence:CCGGGTGAGTACTTACATCTAGCATCTCGAGATGCTAGATGTAAGTACTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001010882.1-2378s1c1
Sequence:CCGGCCTGCTTAGTTCTTACAATTTCTCGAGAAATTGTAAGAACTAAGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)