EMAIL THIS PAGE TO A FRIEND

LOC284751

12 Gene Product Result for
Species: Human LOC284751(284751)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001025463 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001025463 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001025463 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025463 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025463 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110580 predicted 326
2 SASI_Hs01_00110581 predicted 302
3 SASI_Hs01_00110582 predicted 334
4 SASI_Hs01_00110583 predicted 331
5 SASI_Hs01_00110584 predicted 338
6 SASI_Hs01_00110585 predicted 338
7 SASI_Hs01_00110586 predicted 334
8 SASI_Hs01_00110587 predicted 305
9 SASI_Hs01_00110588 predicted 324
10 SASI_Hs01_00110589 predicted 298
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025463
LOC284751 MISSION shRNA Bacterial Glycerol Stock
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000172232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025463.1-231s1c1
Sequence:CCGGCAAGGGTGTCCTTGTGTCTTTCTCGAGAAAGACACAAGGACACCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025463.1-112s1c1
Sequence:CCGGGTGTAACAAACACACGATAAACTCGAGTTTATCGTGTGTTTGTTACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025463
LOC284751 MISSION shRNA shRNA Plasmid DNA
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000172232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025463.1-231s1c1
Sequence:CCGGCAAGGGTGTCCTTGTGTCTTTCTCGAGAAAGACACAAGGACACCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025463.1-112s1c1
Sequence:CCGGGTGTAACAAACACACGATAAACTCGAGTTTATCGTGTGTTTGTTACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025463
LOC284751 MISSION shRNA Lentiviral Transduction Particles
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000172232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025463.1-231s1c1
Sequence:CCGGCAAGGGTGTCCTTGTGTCTTTCTCGAGAAAGACACAAGGACACCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025463.1-112s1c1
Sequence:CCGGGTGTAACAAACACACGATAAACTCGAGTTTATCGTGTGTTTGTTACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)