EMAIL THIS PAGE TO A FRIEND

LOC284757

40 Gene Product Result for
Species: Human LOC284757(284757)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004305 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004305 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004305 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004305 Rosetta Predictions human pricing
XR_041615 Rosetta Predictions human pricing
XR_041616 Rosetta Predictions human pricing
XR_041617 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004305 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174846 predicted 1548
2 SASI_Hs01_00174847 predicted 1987
3 SASI_Hs01_00174848 predicted 1965
4 SASI_Hs01_00174849 predicted 1585
5 SASI_Hs01_00174850 predicted 1605
6 SASI_Hs01_00174851 predicted 2077
7 SASI_Hs01_00174852 predicted 3501
8 SASI_Hs01_00174853 predicted 3470
9 SASI_Hs01_00174854 predicted 3478
10 SASI_Hs01_00174855 predicted 3462
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041615 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00528902 predicted 76
2 SASI_Hs02_00528903 predicted 73
3 SASI_Hs02_00528904 predicted 27
4 SASI_Hs02_00528905 predicted 51
5 SASI_Hs02_00528906 predicted 30
6 SASI_Hs02_00528907 predicted 89
7 SASI_Hs02_00528908 predicted 28
8 SASI_Hs02_00528909 predicted 28
9 SASI_Hs02_00528910 predicted 24
10 SASI_Hs02_00528911 predicted 77
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041616 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00528912 predicted 28
2 SASI_Hs02_00528913 predicted 29
3 SASI_Hs02_00528914 predicted 47
4 SASI_Hs02_00528915 predicted 76
5 SASI_Hs02_00528916 predicted 23
6 SASI_Hs02_00528917 predicted 83
7 SASI_Hs02_00528918 predicted 23
8 SASI_Hs02_00528919 predicted 20
9 SASI_Hs02_00528920 predicted 382
10 SASI_Hs02_00528921 predicted 24
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041617 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00528922 predicted 76
2 SASI_Hs02_00528923 predicted 80
3 SASI_Hs02_00528924 predicted 25
4 SASI_Hs02_00528925 predicted 52
5 SASI_Hs02_00528926 predicted 28
6 SASI_Hs02_00528927 predicted 84
7 SASI_Hs02_00528928 predicted 22
8 SASI_Hs02_00528929 predicted 20
9 SASI_Hs02_00528930 predicted 20
10 SASI_Hs02_00528931 predicted 82
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004305
LOC284757 MISSION shRNA Bacterial Glycerol Stock
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000172983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004305.1-1639s1c1
Sequence:CCGGCCAGTTCATGCTATCTCCTCACTCGAGTGAGGAGATAGCATGAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004305.1-1586s1c1
Sequence:CCGGGCTTGGTGTAATGTTCACATGCTCGAGCATGTGAACATTACACCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166995    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004305.1-3484s1c1
Sequence:CCGGGCAGTCAAATGAGAAGAGATTCTCGAGAATCTCTTCTCATTTGACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004305
LOC284757 MISSION shRNA shRNA Plasmid DNA
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000172983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004305.1-1639s1c1
Sequence:CCGGCCAGTTCATGCTATCTCCTCACTCGAGTGAGGAGATAGCATGAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004305.1-1586s1c1
Sequence:CCGGGCTTGGTGTAATGTTCACATGCTCGAGCATGTGAACATTACACCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166995    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004305.1-3484s1c1
Sequence:CCGGGCAGTCAAATGAGAAGAGATTCTCGAGAATCTCTTCTCATTTGACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004305
LOC284757 MISSION shRNA Lentiviral Transduction Particles
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000172983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004305.1-1639s1c1
Sequence:CCGGCCAGTTCATGCTATCTCCTCACTCGAGTGAGGAGATAGCATGAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004305.1-1586s1c1
Sequence:CCGGGCTTGGTGTAATGTTCACATGCTCGAGCATGTGAACATTACACCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166995    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004305.1-3484s1c1
Sequence:CCGGGCAGTCAAATGAGAAGAGATTCTCGAGAATCTCTTCTCATTTGACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)