EMAIL THIS PAGE TO A FRIEND

LOC285033

35 Gene Product Result for
Species: Human LOC285033(285033)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001037228 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001037228 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001037228 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU103951 MISSION® esiRNA esiRNA human AC012307.8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037228 Rosetta Predictions human pricing
XM_926672 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037228 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152129 predicted 203
2 SASI_Hs01_00152130 predicted 219
3 SASI_Hs01_00152131 predicted 207
4 SASI_Hs01_00152132 predicted 171
5 SASI_Hs01_00152133 predicted 112
6 SASI_Hs01_00152134 predicted 350
7 SASI_Hs02_00308239 predicted 144
8 SASI_Hs01_00152135 predicted 137
9 SASI_Hs01_00152137 predicted 142
10 SASI_Hs02_00308240 predicted 244
11 SASI_Hs01_00152136 predicted 148
12 SASI_Hs01_00152138 predicted 106
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_926672 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00284959 predicted 362
2 SASI_Hs01_00284960 predicted 496
3 SASI_Hs01_00284961 predicted 645
4 SASI_Hs01_00284962 predicted 317
5 SASI_Hs01_00284963 predicted 418
6 SASI_Hs01_00284964 predicted 294
7 SASI_Hs01_00284965 predicted 621
8 SASI_Hs01_00284966 predicted 461
9 SASI_Hs01_00284967 predicted 337
10 SASI_Hs01_00284968 predicted 574
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037228
LOC285033 MISSION shRNA Bacterial Glycerol Stock
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037228.1-234s1c1
Sequence:CCGGCAAAGACATCTCGGGTCAACTCTCGAGAGTTGACCCGAGATGTCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037228.1-278s1c1
Sequence:CCGGGCCAGTGAGAACACACATTCACTCGAGTGAATGTGTGTTCTCACTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037228.1-143s1c1
Sequence:CCGGGTAGCAGGTAATTTCTTCCGACTCGAGTCGGAAGAAATTACCTGCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037228.1-222s1c1
Sequence:CCGGGAATTGCAAGGCCAAAGACATCTCGAGATGTCTTTGGCCTTGCAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037228.1-136s1c1
Sequence:CCGGGTTCCTCGTAGCAGGTAATTTCTCGAGAAATTACCTGCTACGAGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037228.1-139s1c1
Sequence:CCGGCCTCGTAGCAGGTAATTTCTTCTCGAGAAGAAATTACCTGCTACGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166028    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037228.1-250s1c1
Sequence:CCGGCAACTCTTCTCAGGACCAGATCTCGAGATCTGGTCCTGAGAAGAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037228.1-396s21c1
Sequence:CCGGAGCCTAGGAAGCAAAGTGAAGCTCGAGCTTCACTTTGCTTCCTAGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037228.1-267s21c1
Sequence:CCGGAGATCCAAGTCGCCAGTGAGACTCGAGTCTCACTGGCGACTTGGATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037228.1-340s21c1
Sequence:CCGGTGCTTCATGTGGGCAAGAGCTCTCGAGAGCTCTTGCCCACATGAAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037228
LOC285033 MISSION shRNA shRNA Plasmid DNA
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037228.1-234s1c1
Sequence:CCGGCAAAGACATCTCGGGTCAACTCTCGAGAGTTGACCCGAGATGTCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037228.1-278s1c1
Sequence:CCGGGCCAGTGAGAACACACATTCACTCGAGTGAATGTGTGTTCTCACTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037228.1-143s1c1
Sequence:CCGGGTAGCAGGTAATTTCTTCCGACTCGAGTCGGAAGAAATTACCTGCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037228.1-222s1c1
Sequence:CCGGGAATTGCAAGGCCAAAGACATCTCGAGATGTCTTTGGCCTTGCAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037228.1-136s1c1
Sequence:CCGGGTTCCTCGTAGCAGGTAATTTCTCGAGAAATTACCTGCTACGAGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037228.1-139s1c1
Sequence:CCGGCCTCGTAGCAGGTAATTTCTTCTCGAGAAGAAATTACCTGCTACGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166028    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037228.1-250s1c1
Sequence:CCGGCAACTCTTCTCAGGACCAGATCTCGAGATCTGGTCCTGAGAAGAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037228.1-396s21c1
Sequence:CCGGAGCCTAGGAAGCAAAGTGAAGCTCGAGCTTCACTTTGCTTCCTAGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037228.1-267s21c1
Sequence:CCGGAGATCCAAGTCGCCAGTGAGACTCGAGTCTCACTGGCGACTTGGATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037228.1-340s21c1
Sequence:CCGGTGCTTCATGTGGGCAAGAGCTCTCGAGAGCTCTTGCCCACATGAAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037228
LOC285033 MISSION shRNA Lentiviral Transduction Particles
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037228.1-234s1c1
Sequence:CCGGCAAAGACATCTCGGGTCAACTCTCGAGAGTTGACCCGAGATGTCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037228.1-278s1c1
Sequence:CCGGGCCAGTGAGAACACACATTCACTCGAGTGAATGTGTGTTCTCACTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037228.1-143s1c1
Sequence:CCGGGTAGCAGGTAATTTCTTCCGACTCGAGTCGGAAGAAATTACCTGCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037228.1-222s1c1
Sequence:CCGGGAATTGCAAGGCCAAAGACATCTCGAGATGTCTTTGGCCTTGCAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037228.1-136s1c1
Sequence:CCGGGTTCCTCGTAGCAGGTAATTTCTCGAGAAATTACCTGCTACGAGGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037228.1-139s1c1
Sequence:CCGGCCTCGTAGCAGGTAATTTCTTCTCGAGAAGAAATTACCTGCTACGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166028    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037228.1-250s1c1
Sequence:CCGGCAACTCTTCTCAGGACCAGATCTCGAGATCTGGTCCTGAGAAGAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037228.1-396s21c1
Sequence:CCGGAGCCTAGGAAGCAAAGTGAAGCTCGAGCTTCACTTTGCTTCCTAGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037228.1-267s21c1
Sequence:CCGGAGATCCAAGTCGCCAGTGAGACTCGAGTCTCACTGGCGACTTGGATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037228.1-340s21c1
Sequence:CCGGTGCTTCATGTGGGCAAGAGCTCTCGAGAGCTCTTGCCCACATGAAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)