EMAIL THIS PAGE TO A FRIEND

LOC285074

75 Gene Product Result for
Species: Human LOC285074(285074)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012626 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012626 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012626 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012626 Rosetta Predictions human pricing
XR_040022 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012626 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062015 predicted 677
2 SASI_Hs01_00062016 predicted 676
3 SASI_Hs01_00062017 predicted 407
4 SASI_Hs01_00062018 predicted 407
5 SASI_Hs01_00062019 predicted 824
6 SASI_Hs01_00062020 predicted 824
7 SASI_Hs01_00062021 predicted 811
8 SASI_Hs01_00062022 predicted 907
9 SASI_Hs01_00062023 predicted 864
10 SASI_Hs01_00062024 predicted 660
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040022 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00515233 predicted 622
2 SASI_Hs02_00515234 predicted 966
3 SASI_Hs02_00515235 predicted 226
4 SASI_Hs02_00515236 predicted 1148
5 SASI_Hs02_00515237 predicted 1174
6 SASI_Hs02_00515238 predicted 1201
7 SASI_Hs02_00515239 predicted 833
8 SASI_Hs02_00515240 predicted 1088
9 SASI_Hs02_00515241 predicted 360
10 SASI_Hs02_00515242 predicted 1027
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012626
VALIDATED
LOC285074 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001012626.1-296s1c1
Sequence:CCGGCAGGGACACTTTCACTTGTTTCTCGAGAAACAAGTGAAAGTGTCCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167787    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001012626.1-1716s1c1
Sequence:CCGGGCTTTGGCTATGATCTACTTACTCGAGTAAGTAGATCATAGCCAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012626.1-287s1c1
Sequence:CCGGCTGAATTATCAGGGACACTTTCTCGAGAAAGTGTCCCTGATAATTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001012626.1-286s1c1
Sequence:CCGGGCTGAATTATCAGGGACACTTCTCGAGAAGTGTCCCTGATAATTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001012626.1-283s1c1
Sequence:CCGGGATGCTGAATTATCAGGGACACTCGAGTGTCCCTGATAATTCAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012626
VALIDATED
LOC285074 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001012626.1-296s1c1
Sequence:CCGGCAGGGACACTTTCACTTGTTTCTCGAGAAACAAGTGAAAGTGTCCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167787    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001012626.1-1716s1c1
Sequence:CCGGGCTTTGGCTATGATCTACTTACTCGAGTAAGTAGATCATAGCCAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012626.1-287s1c1
Sequence:CCGGCTGAATTATCAGGGACACTTTCTCGAGAAAGTGTCCCTGATAATTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001012626.1-286s1c1
Sequence:CCGGGCTGAATTATCAGGGACACTTCTCGAGAAGTGTCCCTGATAATTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001012626.1-283s1c1
Sequence:CCGGGATGCTGAATTATCAGGGACACTCGAGTGTCCCTGATAATTCAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012626
VALIDATED
LOC285074 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001012626.1-296s1c1
Sequence:CCGGCAGGGACACTTTCACTTGTTTCTCGAGAAACAAGTGAAAGTGTCCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167787    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001012626.1-1716s1c1
Sequence:CCGGGCTTTGGCTATGATCTACTTACTCGAGTAAGTAGATCATAGCCAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012626.1-287s1c1
Sequence:CCGGCTGAATTATCAGGGACACTTTCTCGAGAAAGTGTCCCTGATAATTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001012626.1-286s1c1
Sequence:CCGGGCTGAATTATCAGGGACACTTCTCGAGAAGTGTCCCTGATAATTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001012626.1-283s1c1
Sequence:CCGGGATGCTGAATTATCAGGGACACTCGAGTGTCCCTGATAATTCAGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)