EMAIL THIS PAGE TO A FRIEND

LOC285299

18 Gene Product Result for
Species: Human LOC285299(285299)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001124759 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001124759 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001124759 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU106521 MISSION® esiRNA esiRNA human FRG2C (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001124759 Rosetta Predictions human pricing
XM_209554 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001124759 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327964 predicted 349
2 SASI_Hs02_00327965 predicted 218
3 SASI_Hs02_00327966 predicted 340
4 SASI_Hs02_00327967 predicted 225
5 SASI_Hs02_00327968 predicted 217
6 SASI_Hs02_00327969 predicted 349
7 SASI_Hs02_00327970 predicted 219
8 SASI_Hs02_00327971 predicted 394
9 SASI_Hs02_00327972 predicted 1049
10 SASI_Hs02_00327973 predicted 1045
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_209554 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00291107 predicted 361
2 SASI_Hs01_00291108 predicted 224
3 SASI_Hs01_00291109 predicted 399
4 SASI_Hs01_00291110 predicted 1047
5 SASI_Hs01_00291111 predicted 354
6 SASI_Hs01_00291112 predicted 1051
7 SASI_Hs01_00291113 predicted 387
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001124759
LOC285299 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001124759.1-300s21c1
Sequence:CCGGGAACCAGAGTCCAGCTCATATCTCGAGATATGAGCTGGACTCTGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001124759.1-587s21c1
Sequence:CCGGAGCTATGTCGGAGGCTGTTTACTCGAGTAAACAGCCTCCGACATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246240    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001124759.1-1050s21c1
Sequence:CCGGAGAATGGTGAGCCCTGAATTTCTCGAGAAATTCAGGGCTCACCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001124759.1-398s21c1
Sequence:CCGGGTGCAACTTGACGTTGAATAACTCGAGTTATTCAACGTCAAGTTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001124759.1-703s21c1
Sequence:CCGGCCCAGGTGCAGACCTTGTATTCTCGAGAATACAAGGTCTGCACCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001124759
LOC285299 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001124759.1-300s21c1
Sequence:CCGGGAACCAGAGTCCAGCTCATATCTCGAGATATGAGCTGGACTCTGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001124759.1-587s21c1
Sequence:CCGGAGCTATGTCGGAGGCTGTTTACTCGAGTAAACAGCCTCCGACATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246240    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001124759.1-1050s21c1
Sequence:CCGGAGAATGGTGAGCCCTGAATTTCTCGAGAAATTCAGGGCTCACCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001124759.1-398s21c1
Sequence:CCGGGTGCAACTTGACGTTGAATAACTCGAGTTATTCAACGTCAAGTTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001124759.1-703s21c1
Sequence:CCGGCCCAGGTGCAGACCTTGTATTCTCGAGAATACAAGGTCTGCACCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001124759
LOC285299 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001124759.1-300s21c1
Sequence:CCGGGAACCAGAGTCCAGCTCATATCTCGAGATATGAGCTGGACTCTGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001124759.1-587s21c1
Sequence:CCGGAGCTATGTCGGAGGCTGTTTACTCGAGTAAACAGCCTCCGACATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246240    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001124759.1-1050s21c1
Sequence:CCGGAGAATGGTGAGCCCTGAATTTCTCGAGAAATTCAGGGCTCACCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001124759.1-398s21c1
Sequence:CCGGGTGCAACTTGACGTTGAATAACTCGAGTTATTCAACGTCAAGTTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001124759.1-703s21c1
Sequence:CCGGCCCAGGTGCAGACCTTGTATTCTCGAGAATACAAGGTCTGCACCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)