EMAIL THIS PAGE TO A FRIEND

LOC285501

22 Gene Product Result for
Species: Human LOC285501(285501)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001085490 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001085490 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001085490 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001085490 Rosetta Predictions human pricing
XM_209640 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085490 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317996 predicted 769
2 SASI_Hs02_00317997 predicted 722
3 SASI_Hs02_00317998 predicted 692
4 SASI_Hs02_00317999 predicted 644
5 SASI_Hs02_00318000 predicted 717
6 SASI_Hs02_00318001 predicted 733
7 SASI_Hs02_00318002 predicted 644
8 SASI_Hs02_00318003 predicted 645
9 SASI_Hs02_00318004 predicted 713
10 SASI_Hs02_00318005 predicted 775
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_209640 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00249535 predicted 905
2 SASI_Hs01_00249536 predicted 879
3 SASI_Hs01_00249537 predicted 961
4 SASI_Hs01_00249538 predicted 972
5 SASI_Hs01_00249539 predicted 772
6 SASI_Hs01_00249540 predicted 726
7 SASI_Hs01_00249541 predicted 711
8 SASI_Hs01_00249542 predicted 634
9 SASI_Hs01_00249543 predicted 717
10 SASI_Hs01_00249544 predicted 762
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085490
LOC285501 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085490.1-500s21c1
Sequence:CCGGCACAGCTGCTTTATGCAATCTCTCGAGAGATTGCATAAAGCAGCTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085490.1-586s21c1
Sequence:CCGGTCAAGGCATCCTTCCACCTCACTCGAGTGAGGTGGAAGGATGCCTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085490.1-625s21c1
Sequence:CCGGACTACAGGAGAGAAGACAATGCTCGAGCATTGTCTTCTCTCCTGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085490.1-638s21c1
Sequence:CCGGAGACAATGAGGTCAGCTAGAACTCGAGTTCTAGCTGACCTCATTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085490.1-613s21c1
Sequence:CCGGCAAGTAGCTGGGACTACAGGACTCGAGTCCTGTAGTCCCAGCTACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085490
LOC285501 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085490.1-500s21c1
Sequence:CCGGCACAGCTGCTTTATGCAATCTCTCGAGAGATTGCATAAAGCAGCTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085490.1-586s21c1
Sequence:CCGGTCAAGGCATCCTTCCACCTCACTCGAGTGAGGTGGAAGGATGCCTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085490.1-625s21c1
Sequence:CCGGACTACAGGAGAGAAGACAATGCTCGAGCATTGTCTTCTCTCCTGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085490.1-638s21c1
Sequence:CCGGAGACAATGAGGTCAGCTAGAACTCGAGTTCTAGCTGACCTCATTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085490.1-613s21c1
Sequence:CCGGCAAGTAGCTGGGACTACAGGACTCGAGTCCTGTAGTCCCAGCTACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085490
LOC285501 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085490.1-500s21c1
Sequence:CCGGCACAGCTGCTTTATGCAATCTCTCGAGAGATTGCATAAAGCAGCTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085490.1-586s21c1
Sequence:CCGGTCAAGGCATCCTTCCACCTCACTCGAGTGAGGTGGAAGGATGCCTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085490.1-625s21c1
Sequence:CCGGACTACAGGAGAGAAGACAATGCTCGAGCATTGTCTTCTCTCCTGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085490.1-638s21c1
Sequence:CCGGAGACAATGAGGTCAGCTAGAACTCGAGTTCTAGCTGACCTCATTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085490.1-613s21c1
Sequence:CCGGCAAGTAGCTGGGACTACAGGACTCGAGTCCTGTAGTCCCAGCTACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)