EMAIL THIS PAGE TO A FRIEND

LOC285696

32 Gene Product Result for
Species: Human LOC285696(285696)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173669 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173669 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173669 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_017758 Rosetta Predictions human pricing
XR_017902 Rosetta Predictions human pricing
XR_039992 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017758 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00494352 predicted 925
2 SASI_Hs02_00494353 predicted 640
3 SASI_Hs02_00494354 predicted 786
4 SASI_Hs02_00494355 predicted 781
5 SASI_Hs02_00494356 predicted 856
6 SASI_Hs02_00494357 predicted 774
7 SASI_Hs02_00494358 predicted 876
8 SASI_Hs02_00494359 predicted 925
9 SASI_Hs02_00494360 predicted 911
10 SASI_Hs02_00494361 predicted 923
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017902 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00494846 predicted 924
2 SASI_Hs02_00494847 predicted 634
3 SASI_Hs02_00494848 predicted 788
4 SASI_Hs02_00494849 predicted 783
5 SASI_Hs02_00494850 predicted 855
6 SASI_Hs02_00494851 predicted 777
7 SASI_Hs02_00494852 predicted 872
8 SASI_Hs02_00494853 predicted 929
9 SASI_Hs02_00494854 predicted 910
10 SASI_Hs02_00494855 predicted 924
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039992 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514951 predicted 732
2 SASI_Hs02_00514952 predicted 450
3 SASI_Hs02_00514953 predicted 598
4 SASI_Hs02_00514954 predicted 587
5 SASI_Hs02_00514955 predicted 662
6 SASI_Hs02_00514956 predicted 580
7 SASI_Hs02_00514957 predicted 675
8 SASI_Hs02_00514958 predicted 736
9 SASI_Hs02_00514959 predicted 715
10 SASI_Hs02_00514960 predicted 725
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173669
LOC285696 MISSION shRNA Bacterial Glycerol Stock
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166069    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173669.1-422s1c1
Sequence:CCGGGCTTTAATGGAGGCCACCAATCTCGAGATTGGTGGCCTCCATTAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173669.1-617s1c1
Sequence:CCGGGTTGGCAAGAGGGACATACAACTCGAGTTGTATGTCCCTCTTGCCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173669.1-588s1c1
Sequence:CCGGGTAGGAAGATGCGTTCACTTTCTCGAGAAAGTGAACGCATCTTCCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163045    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173669.1-1061s1c1
Sequence:CCGGGCAGAACAGTTTCAGTCGATTCTCGAGAATCGACTGAAACTGTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163084    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173669.1-2347s1c1
Sequence:CCGGGCACTACCTTTATGAGCTGTACTCGAGTACAGCTCATAAAGGTAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173669.1-592s1c1
Sequence:CCGGGAAGATGCGTTCACTTTGCTTCTCGAGAAGCAAAGTGAACGCATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165142    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173669.1-598s1c1
Sequence:CCGGGCGTTCACTTTGCTTACCTGTCTCGAGACAGGTAAGCAAAGTGAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164045    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173669.1-599s1c1
Sequence:CCGGCGTTCACTTTGCTTACCTGTTCTCGAGAACAGGTAAGCAAAGTGAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173669
LOC285696 MISSION shRNA shRNA Plasmid DNA
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166069    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173669.1-422s1c1
Sequence:CCGGGCTTTAATGGAGGCCACCAATCTCGAGATTGGTGGCCTCCATTAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173669.1-617s1c1
Sequence:CCGGGTTGGCAAGAGGGACATACAACTCGAGTTGTATGTCCCTCTTGCCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173669.1-588s1c1
Sequence:CCGGGTAGGAAGATGCGTTCACTTTCTCGAGAAAGTGAACGCATCTTCCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163045    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173669.1-1061s1c1
Sequence:CCGGGCAGAACAGTTTCAGTCGATTCTCGAGAATCGACTGAAACTGTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163084    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173669.1-2347s1c1
Sequence:CCGGGCACTACCTTTATGAGCTGTACTCGAGTACAGCTCATAAAGGTAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173669.1-592s1c1
Sequence:CCGGGAAGATGCGTTCACTTTGCTTCTCGAGAAGCAAAGTGAACGCATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165142    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173669.1-598s1c1
Sequence:CCGGGCGTTCACTTTGCTTACCTGTCTCGAGACAGGTAAGCAAAGTGAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164045    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173669.1-599s1c1
Sequence:CCGGCGTTCACTTTGCTTACCTGTTCTCGAGAACAGGTAAGCAAAGTGAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173669
LOC285696 MISSION shRNA Lentiviral Transduction Particles
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166069    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173669.1-422s1c1
Sequence:CCGGGCTTTAATGGAGGCCACCAATCTCGAGATTGGTGGCCTCCATTAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173669.1-617s1c1
Sequence:CCGGGTTGGCAAGAGGGACATACAACTCGAGTTGTATGTCCCTCTTGCCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173669.1-588s1c1
Sequence:CCGGGTAGGAAGATGCGTTCACTTTCTCGAGAAAGTGAACGCATCTTCCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163045    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173669.1-1061s1c1
Sequence:CCGGGCAGAACAGTTTCAGTCGATTCTCGAGAATCGACTGAAACTGTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163084    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173669.1-2347s1c1
Sequence:CCGGGCACTACCTTTATGAGCTGTACTCGAGTACAGCTCATAAAGGTAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173669.1-592s1c1
Sequence:CCGGGAAGATGCGTTCACTTTGCTTCTCGAGAAGCAAAGTGAACGCATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165142    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173669.1-598s1c1
Sequence:CCGGGCGTTCACTTTGCTTACCTGTCTCGAGACAGGTAAGCAAAGTGAACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164045    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173669.1-599s1c1
Sequence:CCGGCGTTCACTTTGCTTACCTGTTCTCGAGAACAGGTAAGCAAAGTGAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)