EMAIL THIS PAGE TO A FRIEND

LOC285697

24 Gene Product Result for
Species: Human LOC285697(285697)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1408489 Anti-LOC285697 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_210642 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_210642 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_210642 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001724289 Rosetta Predictions human pricing
XM_210642 Rosetta Predictions human pricing
XM_941117 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001724289 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00460714 predicted 361
2 SASI_Hs02_00460715 predicted 355
3 SASI_Hs02_00460716 predicted 364
4 SASI_Hs02_00460717 predicted 47
5 SASI_Hs02_00460718 predicted 159
6 SASI_Hs02_00460719 predicted 45
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_210642 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00294270 predicted 48
2 SASI_Hs02_00478992 predicted 49
3 SASI_Hs01_00294264 predicted 273
4 SASI_Hs01_00294265 predicted 269
5 SASI_Hs01_00294266 predicted 204
6 SASI_Hs01_00294267 predicted 203
7 SASI_Hs01_00294268 predicted 266
8 SASI_Hs01_00294269 predicted 242
9 SASI_Hs01_00294271 predicted 359
10 SASI_Hs01_00294272 predicted 334
11 SASI_Hs01_00294273 predicted 352
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_941117 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00484669 predicted 365
2 SASI_Hs02_00484670 predicted 358
3 SASI_Hs02_00484671 predicted 360
4 SASI_Hs02_00484672 predicted 46
5 SASI_Hs02_00484673 predicted 159
6 SASI_Hs02_00484674 predicted 54
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_210642
LOC285697 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210642.1-126s1c1
Sequence:CCGGTGACAAAGAAACCTCAGCCTCCTCGAGGAGGCTGAGGTTTCTTTGTCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210642.1-183s1c1
Sequence:CCGGCAAAGGAAAGAAGGAGAGGAACTCGAGTTCCTCTCCTTCTTTCCTTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210642.1-321s1c1
Sequence:CCGGTGCAGCTCTGATGCAGTCTATCTCGAGATAGACTGCATCAGAGCTGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210642.1-119s1c1
Sequence:CCGGCAGAAGGTGACAAAGAAACCTCTCGAGAGGTTTCTTTGTCACCTTCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210642.1-49s1c1
Sequence:CCGGCTAGATGGGAACTTGGAAGAACTCGAGTTCTTCCAAGTTCCCATCTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_210642
LOC285697 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210642.1-126s1c1
Sequence:CCGGTGACAAAGAAACCTCAGCCTCCTCGAGGAGGCTGAGGTTTCTTTGTCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210642.1-183s1c1
Sequence:CCGGCAAAGGAAAGAAGGAGAGGAACTCGAGTTCCTCTCCTTCTTTCCTTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210642.1-321s1c1
Sequence:CCGGTGCAGCTCTGATGCAGTCTATCTCGAGATAGACTGCATCAGAGCTGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210642.1-119s1c1
Sequence:CCGGCAGAAGGTGACAAAGAAACCTCTCGAGAGGTTTCTTTGTCACCTTCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210642.1-49s1c1
Sequence:CCGGCTAGATGGGAACTTGGAAGAACTCGAGTTCTTCCAAGTTCCCATCTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_210642
LOC285697 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210642.1-126s1c1
Sequence:CCGGTGACAAAGAAACCTCAGCCTCCTCGAGGAGGCTGAGGTTTCTTTGTCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210642.1-183s1c1
Sequence:CCGGCAAAGGAAAGAAGGAGAGGAACTCGAGTTCCTCTCCTTCTTTCCTTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210642.1-321s1c1
Sequence:CCGGTGCAGCTCTGATGCAGTCTATCTCGAGATAGACTGCATCAGAGCTGCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210642.1-119s1c1
Sequence:CCGGCAGAAGGTGACAAAGAAACCTCTCGAGAGGTTTCTTTGTCACCTTCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210642.1-49s1c1
Sequence:CCGGCTAGATGGGAACTTGGAAGAACTCGAGTTCTTCCAAGTTCCCATCTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)