EMAIL THIS PAGE TO A FRIEND

LOC285766

Gene Product Result for
Species: Human LOC285766(285766)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010885
LOC285766 MISSION shRNA Bacterial Glycerol Stock
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010885.1-589s1c1
Sequence:CCGGGTCAACACAGAGAGATGAGCTCTCGAGAGCTCATCTCTCTGTGTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010885.1-718s1c1
Sequence:CCGGGTCCCACCCTTATTTCTCTTTCTCGAGAAAGAGAAATAAGGGTGGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163619    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010885.1-935s1c1
Sequence:CCGGGCCCAGATGAAACTTCATGATCTCGAGATCATGAAGTTTCATCTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010885.1-748s1c1
Sequence:CCGGGCAAACTCCCTTTAAGCAAGACTCGAGTCTTGCTTAAAGGGAGTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010885.1-749s1c1
Sequence:CCGGCAAACTCCCTTTAAGCAAGAACTCGAGTTCTTGCTTAAAGGGAGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163907    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010885.1-1798s1c1
Sequence:CCGGCCCGTACAGAGTTGTTCAAATCTCGAGATTTGAACAACTCTGTACGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010885
LOC285766 MISSION shRNA shRNA Plasmid DNA
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010885.1-589s1c1
Sequence:CCGGGTCAACACAGAGAGATGAGCTCTCGAGAGCTCATCTCTCTGTGTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010885.1-718s1c1
Sequence:CCGGGTCCCACCCTTATTTCTCTTTCTCGAGAAAGAGAAATAAGGGTGGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163619    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010885.1-935s1c1
Sequence:CCGGGCCCAGATGAAACTTCATGATCTCGAGATCATGAAGTTTCATCTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010885.1-748s1c1
Sequence:CCGGGCAAACTCCCTTTAAGCAAGACTCGAGTCTTGCTTAAAGGGAGTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010885.1-749s1c1
Sequence:CCGGCAAACTCCCTTTAAGCAAGAACTCGAGTTCTTGCTTAAAGGGAGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163907    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010885.1-1798s1c1
Sequence:CCGGCCCGTACAGAGTTGTTCAAATCTCGAGATTTGAACAACTCTGTACGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010885
LOC285766 MISSION shRNA Lentiviral Transduction Particles
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010885.1-589s1c1
Sequence:CCGGGTCAACACAGAGAGATGAGCTCTCGAGAGCTCATCTCTCTGTGTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010885.1-718s1c1
Sequence:CCGGGTCCCACCCTTATTTCTCTTTCTCGAGAAAGAGAAATAAGGGTGGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163619    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010885.1-935s1c1
Sequence:CCGGGCCCAGATGAAACTTCATGATCTCGAGATCATGAAGTTTCATCTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010885.1-748s1c1
Sequence:CCGGGCAAACTCCCTTTAAGCAAGACTCGAGTCTTGCTTAAAGGGAGTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010885.1-749s1c1
Sequence:CCGGCAAACTCCCTTTAAGCAAGAACTCGAGTTCTTGCTTAAAGGGAGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163907    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010885.1-1798s1c1
Sequence:CCGGCCCGTACAGAGTTGTTCAAATCTCGAGATTTGAACAACTCTGTACGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)