EMAIL THIS PAGE TO A FRIEND

LOC285889

Gene Product Result for
Species: Human LOC285889(285889)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_380160
LOC285889 MISSION shRNA Bacterial Glycerol Stock
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000121693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380160.1-246s1c1
Sequence:CCGGGAACCAAATCTGATACTGGATCTCGAGATCCAGTATCAGATTTGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_380160
LOC285889 MISSION shRNA shRNA Plasmid DNA
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000121693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380160.1-246s1c1
Sequence:CCGGGAACCAAATCTGATACTGGATCTCGAGATCCAGTATCAGATTTGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_380160
LOC285889 MISSION shRNA Lentiviral Transduction Particles
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000121693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380160.1-246s1c1
Sequence:CCGGGAACCAAATCTGATACTGGATCTCGAGATCCAGTATCAGATTTGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)