EMAIL THIS PAGE TO A FRIEND

LOC286238

12 Gene Product Result for
Species: Human LOC286238(286238)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_379684 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_379684 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_379684 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001100111 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001100111 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001100111 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100111 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100111 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321634 predicted 305
2 SASI_Hs02_00321635 predicted 334
3 SASI_Hs02_00321636 predicted 277
4 SASI_Hs02_00321637 predicted 352
5 SASI_Hs02_00321638 predicted 366
6 SASI_Hs02_00321639 predicted 446
7 SASI_Hs02_00321640 predicted 301
8 SASI_Hs02_00321641 predicted 412
9 SASI_Hs02_00321642 predicted 341
10 SASI_Hs02_00321643 predicted 304
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_379684
LOC286238 MISSION shRNA Bacterial Glycerol Stock
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000137330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379684.1-190s1c1
Sequence:CCGGGCAGGAAGACAGCAAGGAATACTCGAGTATTCCTTGCTGTCTTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379684.1-255s1c1
Sequence:CCGGGAGACCTGGAAATGTGTTCATCTCGAGATGAACACATTTCCAGGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379684.1-199s1c1
Sequence:CCGGCAGCAAGGAATAGCAGTGAAACTCGAGTTTCACTGCTATTCCTTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_379684
LOC286238 MISSION shRNA shRNA Plasmid DNA
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000137330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379684.1-190s1c1
Sequence:CCGGGCAGGAAGACAGCAAGGAATACTCGAGTATTCCTTGCTGTCTTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379684.1-255s1c1
Sequence:CCGGGAGACCTGGAAATGTGTTCATCTCGAGATGAACACATTTCCAGGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379684.1-199s1c1
Sequence:CCGGCAGCAAGGAATAGCAGTGAAACTCGAGTTTCACTGCTATTCCTTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_379684
LOC286238 MISSION shRNA Lentiviral Transduction Particles
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000137330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379684.1-190s1c1
Sequence:CCGGGCAGGAAGACAGCAAGGAATACTCGAGTATTCCTTGCTGTCTTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379684.1-255s1c1
Sequence:CCGGGAGACCTGGAAATGTGTTCATCTCGAGATGAACACATTTCCAGGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_379684.1-199s1c1
Sequence:CCGGCAGCAAGGAATAGCAGTGAAACTCGAGTTTCACTGCTATTCCTTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001100111
LOC286238 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000268519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001100111.1-474s21c1
Sequence:CCGGTGATGACGGCACCAGTGAAATCTCGAGATTTCACTGGTGCCGTCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100111.1-186s21c1
Sequence:CCGGCAAAGGCACAGAGGGATAAACCTCGAGGTTTATCCCTCTGTGCCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100111.1-269s21c1
Sequence:CCGGTCACTGCTGAGACCTGGAAATCTCGAGATTTCCAGGTCTCAGCAGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100111.1-340s21c1
Sequence:CCGGGATGATAAACAGAGACAATATCTCGAGATATTGTCTCTGTTTATCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100111.1-310s21c1
Sequence:CCGGAGGAGAGATGATAACTCATTACTCGAGTAATGAGTTATCATCTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001100111
LOC286238 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000268519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001100111.1-474s21c1
Sequence:CCGGTGATGACGGCACCAGTGAAATCTCGAGATTTCACTGGTGCCGTCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100111.1-186s21c1
Sequence:CCGGCAAAGGCACAGAGGGATAAACCTCGAGGTTTATCCCTCTGTGCCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100111.1-269s21c1
Sequence:CCGGTCACTGCTGAGACCTGGAAATCTCGAGATTTCCAGGTCTCAGCAGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100111.1-340s21c1
Sequence:CCGGGATGATAAACAGAGACAATATCTCGAGATATTGTCTCTGTTTATCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100111.1-310s21c1
Sequence:CCGGAGGAGAGATGATAACTCATTACTCGAGTAATGAGTTATCATCTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001100111
LOC286238 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000268519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001100111.1-474s21c1
Sequence:CCGGTGATGACGGCACCAGTGAAATCTCGAGATTTCACTGGTGCCGTCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100111.1-186s21c1
Sequence:CCGGCAAAGGCACAGAGGGATAAACCTCGAGGTTTATCCCTCTGTGCCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100111.1-269s21c1
Sequence:CCGGTCACTGCTGAGACCTGGAAATCTCGAGATTTCCAGGTCTCAGCAGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100111.1-340s21c1
Sequence:CCGGGATGATAAACAGAGACAATATCTCGAGATATTGTCTCTGTTTATCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100111.1-310s21c1
Sequence:CCGGAGGAGAGATGATAACTCATTACTCGAGTAATGAGTTATCATCTCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)