EMAIL THIS PAGE TO A FRIEND

LOC286297

30 Gene Product Result for
Species: Human LOC286297(286297)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372099 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372099 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372099 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_372109 Rosetta Predictions human pricing
XM_933054 Rosetta Predictions human pricing
XM_933058 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_372109 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247996 predicted 228
2 SASI_Hs01_00247997 predicted 293
3 SASI_Hs01_00247998 predicted 225
4 SASI_Hs01_00247999 predicted 307
5 SASI_Hs01_00248000 predicted 301
6 SASI_Hs01_00248001 predicted 312
7 SASI_Hs01_00248002 predicted 299
8 SASI_Hs01_00248003 predicted 223
9 SASI_Hs01_00248004 predicted 228
10 SASI_Hs01_00248005 predicted 212
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933054 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00255248 predicted 561
2 SASI_Hs01_00255249 predicted 812
3 SASI_Hs01_00255250 predicted 389
4 SASI_Hs01_00255251 predicted 904
5 SASI_Hs01_00255252 predicted 958
6 SASI_Hs01_00255253 predicted 673
7 SASI_Hs01_00255254 predicted 1005
8 SASI_Hs01_00255255 predicted 682
9 SASI_Hs01_00255256 predicted 903
10 SASI_Hs01_00255257 predicted 559
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933058 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00267837 predicted 469
2 SASI_Hs01_00267838 predicted 719
3 SASI_Hs01_00267839 predicted 295
4 SASI_Hs01_00267840 predicted 806
5 SASI_Hs01_00267841 predicted 868
6 SASI_Hs01_00267842 predicted 588
7 SASI_Hs01_00267843 predicted 905
8 SASI_Hs01_00267844 predicted 592
9 SASI_Hs01_00267845 predicted 805
10 SASI_Hs01_00267846 predicted 468
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372099
LOC286297 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372099.2-230s1c1
Sequence:CCGGGCATGGCAAAGACCGATCTTTCTCGAGAAAGATCGGTCTTTGCCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372099.2-136s1c1
Sequence:CCGGGCTGTCTATGGAGCCAAAGATCTCGAGATCTTTGGCTCCATAGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372099.2-148s1c1
Sequence:CCGGGCCAAAGATATCGAACTCTGTCTCGAGACAGAGTTCGATATCTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372099.2-192s1c1
Sequence:CCGGTCGTTACACTCAGCAGGGTTTCTCGAGAAACCCTGCTGAGTGTAACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372099.2-109s1c1
Sequence:CCGGGTGGACAAGATAAGGACCATTCTCGAGAATGGTCCTTATCTTGTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372099
LOC286297 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372099.2-230s1c1
Sequence:CCGGGCATGGCAAAGACCGATCTTTCTCGAGAAAGATCGGTCTTTGCCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372099.2-136s1c1
Sequence:CCGGGCTGTCTATGGAGCCAAAGATCTCGAGATCTTTGGCTCCATAGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372099.2-148s1c1
Sequence:CCGGGCCAAAGATATCGAACTCTGTCTCGAGACAGAGTTCGATATCTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372099.2-192s1c1
Sequence:CCGGTCGTTACACTCAGCAGGGTTTCTCGAGAAACCCTGCTGAGTGTAACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372099.2-109s1c1
Sequence:CCGGGTGGACAAGATAAGGACCATTCTCGAGAATGGTCCTTATCTTGTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372099
LOC286297 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372099.2-230s1c1
Sequence:CCGGGCATGGCAAAGACCGATCTTTCTCGAGAAAGATCGGTCTTTGCCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372099.2-136s1c1
Sequence:CCGGGCTGTCTATGGAGCCAAAGATCTCGAGATCTTTGGCTCCATAGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372099.2-148s1c1
Sequence:CCGGGCCAAAGATATCGAACTCTGTCTCGAGACAGAGTTCGATATCTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372099.2-192s1c1
Sequence:CCGGTCGTTACACTCAGCAGGGTTTCTCGAGAAACCCTGCTGAGTGTAACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372099.2-109s1c1
Sequence:CCGGGTGGACAAGATAAGGACCATTCTCGAGAATGGTCCTTATCTTGTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)