EMAIL THIS PAGE TO A FRIEND

LOC286453

8 Gene Product Result for
Species: Human LOC286453(286453)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001007535 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001007535 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001007535 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007535 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007535 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233956 predicted 343
2 SASI_Hs01_00233957 predicted 812
3 SASI_Hs01_00233958 predicted 732
4 SASI_Hs01_00233959 predicted 349
5 SASI_Hs01_00233960 predicted 468
6 SASI_Hs01_00233961 predicted 80
7 SASI_Hs01_00233962 predicted 22
8 SASI_Hs01_00233963 predicted 19
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007535
LOC286453 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007535.1-68s1c1
Sequence:CCGGGTGGAGAAGATGTTCATCTTTCTCGAGAAAGATGAACATCTTCTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007535.1-206s1c1
Sequence:CCGGGCATCCAGTCTAAAGCCATAACTCGAGTTATGGCTTTAGACTGGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179149    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007535.1-774s1c1
Sequence:CCGGGCGTGCTTGATTTGATAGCTTCTCGAGAAGCTATCAAATCAAGCACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178871    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007535.1-808s1c1
Sequence:CCGGCCACTGAAGCAGAGGATAATTCTCGAGAATTATCCTCTGCTTCAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007535.1-308s1c1
Sequence:CCGGCAAACAGCGAAGCTGTTGGTTCTCGAGAACCAACAGCTTCGCTGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007535
LOC286453 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007535.1-68s1c1
Sequence:CCGGGTGGAGAAGATGTTCATCTTTCTCGAGAAAGATGAACATCTTCTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007535.1-206s1c1
Sequence:CCGGGCATCCAGTCTAAAGCCATAACTCGAGTTATGGCTTTAGACTGGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179149    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007535.1-774s1c1
Sequence:CCGGGCGTGCTTGATTTGATAGCTTCTCGAGAAGCTATCAAATCAAGCACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178871    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007535.1-808s1c1
Sequence:CCGGCCACTGAAGCAGAGGATAATTCTCGAGAATTATCCTCTGCTTCAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007535.1-308s1c1
Sequence:CCGGCAAACAGCGAAGCTGTTGGTTCTCGAGAACCAACAGCTTCGCTGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007535
LOC286453 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007535.1-68s1c1
Sequence:CCGGGTGGAGAAGATGTTCATCTTTCTCGAGAAAGATGAACATCTTCTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007535.1-206s1c1
Sequence:CCGGGCATCCAGTCTAAAGCCATAACTCGAGTTATGGCTTTAGACTGGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179149    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007535.1-774s1c1
Sequence:CCGGGCGTGCTTGATTTGATAGCTTCTCGAGAAGCTATCAAATCAAGCACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178871    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007535.1-808s1c1
Sequence:CCGGCCACTGAAGCAGAGGATAATTCTCGAGAATTATCCTCTGCTTCAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007535.1-308s1c1
Sequence:CCGGCAAACAGCGAAGCTGTTGGTTCTCGAGAACCAACAGCTTCGCTGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)