EMAIL THIS PAGE TO A FRIEND

LOC338797

40 Gene Product Result for
Species: Human LOC338797(338797)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_290579 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_290579 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_290579 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025466 Rosetta Predictions human pricing
XR_041443 Rosetta Predictions human pricing
XR_041444 Rosetta Predictions human pricing
XR_041445 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025466 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159503 predicted 246
2 SASI_Hs01_00159504 predicted 281
3 SASI_Hs01_00159505 predicted 245
4 SASI_Hs01_00159506 predicted 245
5 SASI_Hs01_00159507 predicted 283
6 SASI_Hs01_00159508 predicted 254
7 SASI_Hs01_00159509 predicted 225
8 SASI_Hs01_00159510 predicted 228
9 SASI_Hs01_00159511 predicted 259
10 SASI_Hs01_00159512 predicted 276
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041443 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00527419 predicted 271
2 SASI_Hs02_00527420 predicted 309
3 SASI_Hs02_00527421 predicted 279
4 SASI_Hs02_00527422 predicted 181
5 SASI_Hs02_00527423 predicted 33
6 SASI_Hs02_00527424 predicted 243
7 SASI_Hs02_00527425 predicted 274
8 SASI_Hs02_00527426 predicted 253
9 SASI_Hs02_00527427 predicted 85
10 SASI_Hs02_00527428 predicted 216
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041444 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00527429 predicted 227
2 SASI_Hs02_00527430 predicted 264
3 SASI_Hs02_00527431 predicted 228
4 SASI_Hs02_00527432 predicted 265
5 SASI_Hs02_00527433 predicted 242
6 SASI_Hs02_00527434 predicted 217
7 SASI_Hs02_00527435 predicted 227
8 SASI_Hs02_00527436 predicted 248
9 SASI_Hs02_00527437 predicted 220
10 SASI_Hs02_00527438 predicted 320
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041445 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00527439 predicted 271
2 SASI_Hs02_00527440 predicted 314
3 SASI_Hs02_00527441 predicted 273
4 SASI_Hs02_00527442 predicted 174
5 SASI_Hs02_00527443 predicted 31
6 SASI_Hs02_00527444 predicted 246
7 SASI_Hs02_00527445 predicted 272
8 SASI_Hs02_00527446 predicted 256
9 SASI_Hs02_00527447 predicted 88
10 SASI_Hs02_00527448 predicted 217
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_290579
LOC338797 MISSION shRNA Bacterial Glycerol Stock
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000188945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290579.3-2008s1c1
Sequence:CCGGGCCAGGATGCTCTTGAACAAACTCGAGTTTGTTCAAGAGCATCCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290579.3-2013s1c1
Sequence:CCGGGATGCTCTTGAACAAATGGAACTCGAGTTCCATTTGTTCAAGAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290579.3-2016s1c1
Sequence:CCGGGCTCTTGAACAAATGGAAGTTCTCGAGAACTTCCATTTGTTCAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_290579
LOC338797 MISSION shRNA shRNA Plasmid DNA
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000188945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290579.3-2008s1c1
Sequence:CCGGGCCAGGATGCTCTTGAACAAACTCGAGTTTGTTCAAGAGCATCCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290579.3-2013s1c1
Sequence:CCGGGATGCTCTTGAACAAATGGAACTCGAGTTCCATTTGTTCAAGAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290579.3-2016s1c1
Sequence:CCGGGCTCTTGAACAAATGGAAGTTCTCGAGAACTTCCATTTGTTCAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_290579
LOC338797 MISSION shRNA Lentiviral Transduction Particles
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000188945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290579.3-2008s1c1
Sequence:CCGGGCCAGGATGCTCTTGAACAAACTCGAGTTTGTTCAAGAGCATCCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290579.3-2013s1c1
Sequence:CCGGGATGCTCTTGAACAAATGGAACTCGAGTTCCATTTGTTCAAGAGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290579.3-2016s1c1
Sequence:CCGGGCTCTTGAACAAATGGAAGTTCTCGAGAACTTCCATTTGTTCAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)