EMAIL THIS PAGE TO A FRIEND

LOC339524

42 Gene Product Result for
Species: Human LOC339524(339524)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207357 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207357 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207357 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207357 Rosetta Predictions human pricing
XR_039940 Rosetta Predictions human pricing
XR_039941 Rosetta Predictions human pricing
XR_039942 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207357 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111422 predicted 260
2 SASI_Hs01_00111423 predicted 895
3 SASI_Hs01_00111424 predicted 285
4 SASI_Hs01_00111425 predicted 788
5 SASI_Hs01_00111426 predicted 147
6 SASI_Hs01_00111427 predicted 1030
7 SASI_Hs01_00111428 predicted 1353
8 SASI_Hs01_00111429 predicted 958
9 SASI_Hs01_00111430 predicted 1365
10 SASI_Hs01_00111431 predicted 601
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039940 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514453 predicted 2422
2 SASI_Hs02_00514454 predicted 2088
3 SASI_Hs02_00514455 predicted 1862
4 SASI_Hs02_00514456 predicted 2072
5 SASI_Hs02_00514457 predicted 1001
6 SASI_Hs02_00514458 predicted 232
7 SASI_Hs02_00514459 predicted 864
8 SASI_Hs02_00514460 predicted 973
9 SASI_Hs02_00514461 predicted 2225
10 SASI_Hs02_00514462 predicted 1953
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039941 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514463 predicted 2423
2 SASI_Hs02_00514464 predicted 2084
3 SASI_Hs02_00514465 predicted 1860
4 SASI_Hs02_00514466 predicted 2071
5 SASI_Hs02_00514467 predicted 239
6 SASI_Hs02_00514468 predicted 857
7 SASI_Hs02_00514469 predicted 1046
8 SASI_Hs02_00514470 predicted 974
9 SASI_Hs02_00514471 predicted 2224
10 SASI_Hs02_00514472 predicted 1960
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039942 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514473 predicted 2427
2 SASI_Hs02_00514474 predicted 2089
3 SASI_Hs02_00514475 predicted 1864
4 SASI_Hs02_00514476 predicted 2073
5 SASI_Hs02_00514477 predicted 234
6 SASI_Hs02_00514478 predicted 866
7 SASI_Hs02_00514479 predicted 1039
8 SASI_Hs02_00514480 predicted 980
9 SASI_Hs02_00514481 predicted 2220
10 SASI_Hs02_00514482 predicted 1955
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207357
LOC339524 MISSION shRNA Bacterial Glycerol Stock
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207357.1-895s1c1
Sequence:CCGGCGGAGAACAAGGAGTTTCTTTCTCGAGAAAGAAACTCCTTGTTCTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207357.1-884s1c1
Sequence:CCGGCTGAAAGTGAGCGGAGAACAACTCGAGTTGTTCTCCGCTCACTTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207357.1-227s1c1
Sequence:CCGGGCACCCTGTTGTTATTAAGGACTCGAGTCCTTAATAACAACAGGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207357.1-224s1c1
Sequence:CCGGCCAGCACCCTGTTGTTATTAACTCGAGTTAATAACAACAGGGTGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207357.1-223s1c1
Sequence:CCGGCCCAGCACCCTGTTGTTATTACTCGAGTAATAACAACAGGGTGCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168437    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207357.1-2076s1c1
Sequence:CCGGGCACCATGAATGTGACTGATACTCGAGTATCAGTCACATTCATGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207357.1-256s1c1
Sequence:CCGGCTTGGAGCGGCATCATTACAACTCGAGTTGTAATGATGCCGCTCCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168294    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207357.1-1004s1c1
Sequence:CCGGGCTGATGGAAATGTCAGCATTCTCGAGAATGCTGACATTTCCATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207357.1-286s1c1
Sequence:CCGGGTACTACATATACTCCCTATTCTCGAGAATAGGGAGTATATGTAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207357
LOC339524 MISSION shRNA shRNA Plasmid DNA
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207357.1-895s1c1
Sequence:CCGGCGGAGAACAAGGAGTTTCTTTCTCGAGAAAGAAACTCCTTGTTCTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207357.1-884s1c1
Sequence:CCGGCTGAAAGTGAGCGGAGAACAACTCGAGTTGTTCTCCGCTCACTTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207357.1-227s1c1
Sequence:CCGGGCACCCTGTTGTTATTAAGGACTCGAGTCCTTAATAACAACAGGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207357.1-224s1c1
Sequence:CCGGCCAGCACCCTGTTGTTATTAACTCGAGTTAATAACAACAGGGTGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207357.1-223s1c1
Sequence:CCGGCCCAGCACCCTGTTGTTATTACTCGAGTAATAACAACAGGGTGCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168437    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207357.1-2076s1c1
Sequence:CCGGGCACCATGAATGTGACTGATACTCGAGTATCAGTCACATTCATGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207357.1-256s1c1
Sequence:CCGGCTTGGAGCGGCATCATTACAACTCGAGTTGTAATGATGCCGCTCCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168294    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207357.1-1004s1c1
Sequence:CCGGGCTGATGGAAATGTCAGCATTCTCGAGAATGCTGACATTTCCATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207357.1-286s1c1
Sequence:CCGGGTACTACATATACTCCCTATTCTCGAGAATAGGGAGTATATGTAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207357
LOC339524 MISSION shRNA Lentiviral Transduction Particles
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207357.1-895s1c1
Sequence:CCGGCGGAGAACAAGGAGTTTCTTTCTCGAGAAAGAAACTCCTTGTTCTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207357.1-884s1c1
Sequence:CCGGCTGAAAGTGAGCGGAGAACAACTCGAGTTGTTCTCCGCTCACTTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207357.1-227s1c1
Sequence:CCGGGCACCCTGTTGTTATTAAGGACTCGAGTCCTTAATAACAACAGGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207357.1-224s1c1
Sequence:CCGGCCAGCACCCTGTTGTTATTAACTCGAGTTAATAACAACAGGGTGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207357.1-223s1c1
Sequence:CCGGCCCAGCACCCTGTTGTTATTACTCGAGTAATAACAACAGGGTGCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168437    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207357.1-2076s1c1
Sequence:CCGGGCACCATGAATGTGACTGATACTCGAGTATCAGTCACATTCATGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207357.1-256s1c1
Sequence:CCGGCTTGGAGCGGCATCATTACAACTCGAGTTGTAATGATGCCGCTCCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168294    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207357.1-1004s1c1
Sequence:CCGGGCTGATGGAAATGTCAGCATTCTCGAGAATGCTGACATTTCCATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207357.1-286s1c1
Sequence:CCGGGTACTACATATACTCCCTATTCTCGAGAATAGGGAGTATATGTAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)