EMAIL THIS PAGE TO A FRIEND

LOC344065

37 Gene Product Result for
Species: Human LOC344065(344065)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV51006 Anti-LOC344065 antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB2104848 Anti-LOC344065 antibody produced in rabbit affinity isolated antibody mouse, horse, rat, human, rabbit, guinea pig
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_001714518 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001714518 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001714518 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001714518 Rosetta Predictions human pricing
XM_292895 Rosetta Predictions human pricing
XM_936762 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714518 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00397639 predicted 618
2 SASI_Hs02_00397640 predicted 565
3 SASI_Hs02_00397641 predicted 907
4 SASI_Hs02_00397642 predicted 692
5 SASI_Hs02_00397643 predicted 1240
6 SASI_Hs02_00397644 predicted 698
7 SASI_Hs02_00397645 predicted 867
8 SASI_Hs02_00397646 predicted 598
9 SASI_Hs02_00397647 predicted 626
10 SASI_Hs02_00397648 predicted 1234
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_292895 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00255991 predicted 1219
2 SASI_Hs01_00255992 predicted 1225
3 SASI_Hs01_00255994 predicted 1313
4 SASI_Hs01_00255995 predicted 606
5 SASI_Hs01_00255996 predicted 1732
6 SASI_Hs02_00479119 predicted 552
7 SASI_Hs02_00479120 predicted 889
8 SASI_Hs02_00479121 predicted 1805
9 SASI_Hs02_00479122 predicted 1725
10 SASI_Hs02_00479123 predicted 683
11 SASI_Hs01_00255989 predicted 1150
12 SASI_Hs01_00255990 predicted 1128
13 SASI_Hs01_00255993 predicted 1452
14 SASI_Hs01_00255997 predicted 682
15 SASI_Hs01_00255998 predicted 617
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_936762 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00482240 predicted 620
2 SASI_Hs02_00482241 predicted 566
3 SASI_Hs02_00482242 predicted 908
4 SASI_Hs02_00482243 predicted 694
5 SASI_Hs02_00482244 predicted 1233
6 SASI_Hs02_00482245 predicted 697
7 SASI_Hs02_00482246 predicted 863
8 SASI_Hs02_00482247 predicted 597
9 SASI_Hs02_00482248 predicted 629
10 SASI_Hs02_00482249 predicted 1241
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001714518
LOC344065 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714518.1-1572s21c1
Sequence:CCGGAGTGACCGCTCAGCCCTTATTCTCGAGAATAAGGGCTGAGCGGTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714518.1-867s21c1
Sequence:CCGGCTACATCATTGTGATTCATTTCTCGAGAAATGAATCACAATGATGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714518.1-625s21c1
Sequence:CCGGTAACTCCAGAGAAGGATATTTCTCGAGAAATATCCTTCTCTGGAGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714518.1-1404s21c1
Sequence:CCGGAGTGATCGGTCAGGTCTTATCCTCGAGGATAAGACCTGACCGATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714518.1-702s21c1
Sequence:CCGGAGTGAATGTGAGGATTCTTTACTCGAGTAAAGAATCCTCACATTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001714518
LOC344065 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714518.1-1572s21c1
Sequence:CCGGAGTGACCGCTCAGCCCTTATTCTCGAGAATAAGGGCTGAGCGGTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714518.1-867s21c1
Sequence:CCGGCTACATCATTGTGATTCATTTCTCGAGAAATGAATCACAATGATGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714518.1-625s21c1
Sequence:CCGGTAACTCCAGAGAAGGATATTTCTCGAGAAATATCCTTCTCTGGAGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714518.1-1404s21c1
Sequence:CCGGAGTGATCGGTCAGGTCTTATCCTCGAGGATAAGACCTGACCGATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714518.1-702s21c1
Sequence:CCGGAGTGAATGTGAGGATTCTTTACTCGAGTAAAGAATCCTCACATTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001714518
LOC344065 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714518.1-1572s21c1
Sequence:CCGGAGTGACCGCTCAGCCCTTATTCTCGAGAATAAGGGCTGAGCGGTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714518.1-867s21c1
Sequence:CCGGCTACATCATTGTGATTCATTTCTCGAGAAATGAATCACAATGATGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714518.1-625s21c1
Sequence:CCGGTAACTCCAGAGAAGGATATTTCTCGAGAAATATCCTTCTCTGGAGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714518.1-1404s21c1
Sequence:CCGGAGTGATCGGTCAGGTCTTATCCTCGAGGATAAGACCTGACCGATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001714518.1-702s21c1
Sequence:CCGGAGTGAATGTGAGGATTCTTTACTCGAGTAAAGAATCCTCACATTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)