EMAIL THIS PAGE TO A FRIEND

LOC345051

40 Gene Product Result for
Species: Human LOC345051(345051)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_293680 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_293680 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_293680 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_293680 Rosetta Predictions human pricing
XR_040587 Rosetta Predictions human pricing
XR_040588 Rosetta Predictions human pricing
XR_040589 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_293680 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00257527 predicted 252
2 SASI_Hs01_00257528 predicted 1335
3 SASI_Hs01_00257529 predicted 219
4 SASI_Hs01_00257530 predicted 248
5 SASI_Hs01_00257531 predicted 225
6 SASI_Hs01_00257532 predicted 305
7 SASI_Hs01_00257533 predicted 1261
8 SASI_Hs01_00257534 predicted 1237
9 SASI_Hs01_00257535 predicted 1321
10 SASI_Hs01_00257536 predicted 261
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040587 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00520185 predicted 683
2 SASI_Hs02_00520186 predicted 684
3 SASI_Hs02_00520187 predicted 217
4 SASI_Hs02_00520188 predicted 1323
5 SASI_Hs02_00520189 predicted 203
6 SASI_Hs02_00520190 predicted 464
7 SASI_Hs02_00520191 predicted 949
8 SASI_Hs02_00520192 predicted 1306
9 SASI_Hs02_00520193 predicted 860
10 SASI_Hs02_00520194 predicted 1168
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040588 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00520195 predicted 897
2 SASI_Hs02_00520196 predicted 418
3 SASI_Hs02_00520197 predicted 1531
4 SASI_Hs02_00520198 predicted 414
5 SASI_Hs02_00520199 predicted 678
6 SASI_Hs02_00520200 predicted 1163
7 SASI_Hs02_00520201 predicted 1517
8 SASI_Hs02_00520202 predicted 476
9 SASI_Hs02_00520203 predicted 1076
10 SASI_Hs02_00520204 predicted 1378
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040589 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00520205 predicted 693
2 SASI_Hs02_00520206 predicted 685
3 SASI_Hs02_00520207 predicted 220
4 SASI_Hs02_00520208 predicted 1330
5 SASI_Hs02_00520209 predicted 209
6 SASI_Hs02_00520210 predicted 476
7 SASI_Hs02_00520211 predicted 962
8 SASI_Hs02_00520212 predicted 1314
9 SASI_Hs02_00520213 predicted 867
10 SASI_Hs02_00520214 predicted 1173
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_293680
LOC345051 MISSION shRNA Bacterial Glycerol Stock
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_293680.2-286s1c1
Sequence:CCGGGCTGGCACTTTCGTTCTCATTCTCGAGAATGAGAACGAAAGTGCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204470    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_293680.2-1419s1c1
Sequence:CCGGCCAGCAGACAGAAGTGTCTTTCTCGAGAAAGACACTTCTGTCTGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_293680.2-1053s1c1
Sequence:CCGGCCTCTGGTCCTCTGAAACTTTCTCGAGAAAGTTTCAGAGGACCAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_293680.2-262s1c1
Sequence:CCGGCGAAGAGTGTCCGATCATCAACTCGAGTTGATGATCGGACACTCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_293680.2-228s1c1
Sequence:CCGGCAGTCGTGATTTCATGGGATTCTCGAGAATCCCATGAAATCACGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_293680.2-311s1c1
Sequence:CCGGCTCATTCCAAACTGATGACTTCTCGAGAAGTCATCAGTTTGGAATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_293680
LOC345051 MISSION shRNA shRNA Plasmid DNA
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_293680.2-286s1c1
Sequence:CCGGGCTGGCACTTTCGTTCTCATTCTCGAGAATGAGAACGAAAGTGCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204470    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_293680.2-1419s1c1
Sequence:CCGGCCAGCAGACAGAAGTGTCTTTCTCGAGAAAGACACTTCTGTCTGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_293680.2-1053s1c1
Sequence:CCGGCCTCTGGTCCTCTGAAACTTTCTCGAGAAAGTTTCAGAGGACCAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_293680.2-262s1c1
Sequence:CCGGCGAAGAGTGTCCGATCATCAACTCGAGTTGATGATCGGACACTCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_293680.2-228s1c1
Sequence:CCGGCAGTCGTGATTTCATGGGATTCTCGAGAATCCCATGAAATCACGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_293680.2-311s1c1
Sequence:CCGGCTCATTCCAAACTGATGACTTCTCGAGAAGTCATCAGTTTGGAATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_293680
LOC345051 MISSION shRNA Lentiviral Transduction Particles
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_293680.2-286s1c1
Sequence:CCGGGCTGGCACTTTCGTTCTCATTCTCGAGAATGAGAACGAAAGTGCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204470    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_293680.2-1419s1c1
Sequence:CCGGCCAGCAGACAGAAGTGTCTTTCTCGAGAAAGACACTTCTGTCTGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_293680.2-1053s1c1
Sequence:CCGGCCTCTGGTCCTCTGAAACTTTCTCGAGAAAGTTTCAGAGGACCAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_293680.2-262s1c1
Sequence:CCGGCGAAGAGTGTCCGATCATCAACTCGAGTTGATGATCGGACACTCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203667    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_293680.2-228s1c1
Sequence:CCGGCAGTCGTGATTTCATGGGATTCTCGAGAATCCCATGAAATCACGACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_293680.2-311s1c1
Sequence:CCGGCTCATTCCAAACTGATGACTTCTCGAGAAGTCATCAGTTTGGAATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)