EMAIL THIS PAGE TO A FRIEND

LOC345576

Gene Product Result for
Species: Human LOC345576(345576)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_293886
LOC345576 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293886.3-337s1c1
Sequence:CCGGCCCAAGTTTGATAAAGCTCATCTCGAGATGAGCTTTATCAAACTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293886.3-234s1c1
Sequence:CCGGTGATGGCAATAAAGCAATGATCTCGAGATCATTGCTTTATTGCCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293886.3-132s1c1
Sequence:CCGGCCTCTCTCAGATCATGGAATTCTCGAGAATTCCATGATCTGAGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293886.3-401s1c1
Sequence:CCGGGCTTGAATTACTGTGGGCATACTCGAGTATGCCCACAGTAATTCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293886.3-208s1c1
Sequence:CCGGCGGCCAGCAATGTTAGATAATCTCGAGATTATCTAACATTGCTGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_293886
LOC345576 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293886.3-337s1c1
Sequence:CCGGCCCAAGTTTGATAAAGCTCATCTCGAGATGAGCTTTATCAAACTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293886.3-234s1c1
Sequence:CCGGTGATGGCAATAAAGCAATGATCTCGAGATCATTGCTTTATTGCCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293886.3-132s1c1
Sequence:CCGGCCTCTCTCAGATCATGGAATTCTCGAGAATTCCATGATCTGAGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293886.3-401s1c1
Sequence:CCGGGCTTGAATTACTGTGGGCATACTCGAGTATGCCCACAGTAATTCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293886.3-208s1c1
Sequence:CCGGCGGCCAGCAATGTTAGATAATCTCGAGATTATCTAACATTGCTGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_293886
LOC345576 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293886.3-337s1c1
Sequence:CCGGCCCAAGTTTGATAAAGCTCATCTCGAGATGAGCTTTATCAAACTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293886.3-234s1c1
Sequence:CCGGTGATGGCAATAAAGCAATGATCTCGAGATCATTGCTTTATTGCCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293886.3-132s1c1
Sequence:CCGGCCTCTCTCAGATCATGGAATTCTCGAGAATTCCATGATCTGAGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293886.3-401s1c1
Sequence:CCGGGCTTGAATTACTGTGGGCATACTCGAGTATGCCCACAGTAATTCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293886.3-208s1c1
Sequence:CCGGCGGCCAGCAATGTTAGATAATCTCGAGATTATCTAACATTGCTGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)