EMAIL THIS PAGE TO A FRIEND

LOC387720

40 Gene Product Result for
Species: Human LOC387720(387720)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013633 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013633 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013633 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013633 Rosetta Predictions human pricing
XR_039801 Rosetta Predictions human pricing
XR_039802 Rosetta Predictions human pricing
XR_039803 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013633 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104477 predicted 1163
2 SASI_Hs01_00104478 predicted 1115
3 SASI_Hs01_00104479 predicted 1167
4 SASI_Hs01_00104480 predicted 422
5 SASI_Hs01_00104481 predicted 1116
6 SASI_Hs01_00104482 predicted 1022
7 SASI_Hs01_00104483 predicted 1130
8 SASI_Hs01_00104484 predicted 1120
9 SASI_Hs01_00104485 predicted 1347
10 SASI_Hs01_00104486 predicted 1249
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039801 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00513232 predicted 1389
2 SASI_Hs02_00513233 predicted 2370
3 SASI_Hs02_00513234 predicted 2481
4 SASI_Hs02_00513235 predicted 2227
5 SASI_Hs02_00513236 predicted 1389
6 SASI_Hs02_00513237 predicted 1694
7 SASI_Hs02_00513238 predicted 2080
8 SASI_Hs02_00513239 predicted 1384
9 SASI_Hs02_00513240 predicted 1888
10 SASI_Hs02_00513241 predicted 2073
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039802 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00513242 predicted 1393
2 SASI_Hs02_00513243 predicted 2369
3 SASI_Hs02_00513244 predicted 2476
4 SASI_Hs02_00513245 predicted 2218
5 SASI_Hs02_00513246 predicted 1392
6 SASI_Hs02_00513247 predicted 1686
7 SASI_Hs02_00513248 predicted 2077
8 SASI_Hs02_00513249 predicted 1380
9 SASI_Hs02_00513250 predicted 1891
10 SASI_Hs02_00513251 predicted 2065
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039803 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00513252 predicted 1386
2 SASI_Hs02_00513253 predicted 2361
3 SASI_Hs02_00513254 predicted 2222
4 SASI_Hs02_00513255 predicted 2150
5 SASI_Hs02_00513256 predicted 2081
6 SASI_Hs02_00513257 predicted 1382
7 SASI_Hs02_00513258 predicted 2065
8 SASI_Hs02_00513259 predicted 2422
9 SASI_Hs02_00513260 predicted 553
10 SASI_Hs02_00513261 predicted 1617
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013633
LOC387720 MISSION shRNA Bacterial Glycerol Stock
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166633    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013633.1-1937s1c1
Sequence:CCGGCTCTGCCTTGACCCAAATCATCTCGAGATGATTTGGGTCAAGGCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166284    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013633.1-1118s1c1
Sequence:CCGGCCCATTTGAGTCAGCGACTTACTCGAGTAAGTCGCTGACTCAAATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166150    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013633.1-1769s1c1
Sequence:CCGGCAAACCCATATCACCGCCTATCTCGAGATAGGCGGTGATATGGGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166122    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013633.1-1721s1c1
Sequence:CCGGCCTCAGCACATGTGTAGCAAACTCGAGTTTGCTACACATGTGCTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165598    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013633.1-2085s1c1
Sequence:CCGGGCTGCTCCTTGTCAAGGATTTCTCGAGAAATCCTTGACAAGGAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160485    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013633.1-1402s1c1
Sequence:CCGGCTTTCCCAAAGATTTCTGATTCTCGAGAATCAGAAATCTTTGGGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162172    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013633.1-1699s1c1
Sequence:CCGGCCTCTTGAAGAAAGTGTCTTTCTCGAGAAAGACACTTTCTTCAAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164294    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013633.1-1162s1c1
Sequence:CCGGCCCAGATCGTAGTTCCAAATTCTCGAGAATTTGGAACTACGATCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013633
LOC387720 MISSION shRNA shRNA Plasmid DNA
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166633    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013633.1-1937s1c1
Sequence:CCGGCTCTGCCTTGACCCAAATCATCTCGAGATGATTTGGGTCAAGGCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166284    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013633.1-1118s1c1
Sequence:CCGGCCCATTTGAGTCAGCGACTTACTCGAGTAAGTCGCTGACTCAAATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166150    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013633.1-1769s1c1
Sequence:CCGGCAAACCCATATCACCGCCTATCTCGAGATAGGCGGTGATATGGGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166122    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013633.1-1721s1c1
Sequence:CCGGCCTCAGCACATGTGTAGCAAACTCGAGTTTGCTACACATGTGCTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165598    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013633.1-2085s1c1
Sequence:CCGGGCTGCTCCTTGTCAAGGATTTCTCGAGAAATCCTTGACAAGGAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160485    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013633.1-1402s1c1
Sequence:CCGGCTTTCCCAAAGATTTCTGATTCTCGAGAATCAGAAATCTTTGGGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162172    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013633.1-1699s1c1
Sequence:CCGGCCTCTTGAAGAAAGTGTCTTTCTCGAGAAAGACACTTTCTTCAAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164294    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013633.1-1162s1c1
Sequence:CCGGCCCAGATCGTAGTTCCAAATTCTCGAGAATTTGGAACTACGATCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013633
LOC387720 MISSION shRNA Lentiviral Transduction Particles
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166633    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013633.1-1937s1c1
Sequence:CCGGCTCTGCCTTGACCCAAATCATCTCGAGATGATTTGGGTCAAGGCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166284    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013633.1-1118s1c1
Sequence:CCGGCCCATTTGAGTCAGCGACTTACTCGAGTAAGTCGCTGACTCAAATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166150    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013633.1-1769s1c1
Sequence:CCGGCAAACCCATATCACCGCCTATCTCGAGATAGGCGGTGATATGGGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166122    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013633.1-1721s1c1
Sequence:CCGGCCTCAGCACATGTGTAGCAAACTCGAGTTTGCTACACATGTGCTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165598    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013633.1-2085s1c1
Sequence:CCGGGCTGCTCCTTGTCAAGGATTTCTCGAGAAATCCTTGACAAGGAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160485    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013633.1-1402s1c1
Sequence:CCGGCTTTCCCAAAGATTTCTGATTCTCGAGAATCAGAAATCTTTGGGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162172    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013633.1-1699s1c1
Sequence:CCGGCCTCTTGAAGAAAGTGTCTTTCTCGAGAAAGACACTTTCTTCAAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164294    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013633.1-1162s1c1
Sequence:CCGGCCCAGATCGTAGTTCCAAATTCTCGAGAATTTGGAACTACGATCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)