EMAIL THIS PAGE TO A FRIEND

LOC388692

42 Gene Product Result for
Species: Human LOC388692(388692)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013644 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013644 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013644 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013644 Rosetta Predictions human pricing
XR_039906 Rosetta Predictions human pricing
XR_039907 Rosetta Predictions human pricing
XR_039908 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013644 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081389 predicted 2420
2 SASI_Hs01_00081390 predicted 2471
3 SASI_Hs01_00081391 predicted 2395
4 SASI_Hs01_00081392 predicted 2413
5 SASI_Hs01_00081393 predicted 2469
6 SASI_Hs01_00081394 predicted 2555
7 SASI_Hs01_00081395 predicted 2254
8 SASI_Hs01_00081396 predicted 2423
9 SASI_Hs01_00081397 predicted 2198
10 SASI_Hs01_00081398 predicted 2407
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039906 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514123 predicted 1167
2 SASI_Hs02_00514124 predicted 868
3 SASI_Hs02_00514125 predicted 832
4 SASI_Hs02_00514126 predicted 843
5 SASI_Hs02_00514127 predicted 1304
6 SASI_Hs02_00514128 predicted 922
7 SASI_Hs02_00514129 predicted 933
8 SASI_Hs02_00514130 predicted 800
9 SASI_Hs02_00514131 predicted 948
10 SASI_Hs02_00514132 predicted 1307
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039907 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514133 predicted 4511
2 SASI_Hs02_00514134 predicted 956
3 SASI_Hs02_00514135 predicted 922
4 SASI_Hs02_00514136 predicted 4687
5 SASI_Hs02_00514137 predicted 3020
6 SASI_Hs02_00514138 predicted 1351
7 SASI_Hs02_00514139 predicted 996
8 SASI_Hs02_00514140 predicted 1048
9 SASI_Hs02_00514141 predicted 5162
10 SASI_Hs02_00514142 predicted 5157
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039908 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514143 predicted 1168
2 SASI_Hs02_00514144 predicted 868
3 SASI_Hs02_00514145 predicted 834
4 SASI_Hs02_00514146 predicted 846
5 SASI_Hs02_00514147 predicted 1312
6 SASI_Hs02_00514148 predicted 919
7 SASI_Hs02_00514149 predicted 933
8 SASI_Hs02_00514150 predicted 799
9 SASI_Hs02_00514151 predicted 944
10 SASI_Hs02_00514152 predicted 1302
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013644
LOC388692 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172953    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013644.1-3237s1c1
Sequence:CCGGGCCAGCCAGATCAACGTAAATCTCGAGATTTACGTTGATCTGGCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168869    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013644.1-2612s1c1
Sequence:CCGGCCACCTTCTTCAGAAACGTAACTCGAGTTACGTTTCTGAAGAAGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013644.1-2539s1c1
Sequence:CCGGGAAGACAGAAGACCACAGTGTCTCGAGACACTGTGGTCTTCTGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168297    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013644.1-3038s1c1
Sequence:CCGGGCTATGCACTTGATTGCCTTTCTCGAGAAAGGCAATCAAGTGCATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166843    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013644.1-2622s1c1
Sequence:CCGGCAGAAACGTAATAGGAATCAACTCGAGTTGATTCCTATTACGTTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013644
LOC388692 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172953    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013644.1-3237s1c1
Sequence:CCGGGCCAGCCAGATCAACGTAAATCTCGAGATTTACGTTGATCTGGCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168869    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013644.1-2612s1c1
Sequence:CCGGCCACCTTCTTCAGAAACGTAACTCGAGTTACGTTTCTGAAGAAGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013644.1-2539s1c1
Sequence:CCGGGAAGACAGAAGACCACAGTGTCTCGAGACACTGTGGTCTTCTGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168297    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013644.1-3038s1c1
Sequence:CCGGGCTATGCACTTGATTGCCTTTCTCGAGAAAGGCAATCAAGTGCATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166843    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013644.1-2622s1c1
Sequence:CCGGCAGAAACGTAATAGGAATCAACTCGAGTTGATTCCTATTACGTTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013644
LOC388692 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172953    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013644.1-3237s1c1
Sequence:CCGGGCCAGCCAGATCAACGTAAATCTCGAGATTTACGTTGATCTGGCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168869    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013644.1-2612s1c1
Sequence:CCGGCCACCTTCTTCAGAAACGTAACTCGAGTTACGTTTCTGAAGAAGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013644.1-2539s1c1
Sequence:CCGGGAAGACAGAAGACCACAGTGTCTCGAGACACTGTGGTCTTCTGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168297    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013644.1-3038s1c1
Sequence:CCGGGCTATGCACTTGATTGCCTTTCTCGAGAAAGGCAATCAAGTGCATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166843    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013644.1-2622s1c1
Sequence:CCGGCAGAAACGTAATAGGAATCAACTCGAGTTGATTCCTATTACGTTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)