EMAIL THIS PAGE TO A FRIEND

LOC388882

40 Gene Product Result for
Species: Human LOC388882(388882)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001006606 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001006606 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001006606 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001006606 Rosetta Predictions human pricing
XR_042117 Rosetta Predictions human pricing
XR_042118 Rosetta Predictions human pricing
XR_042119 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006606 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226649 predicted 459
2 SASI_Hs01_00226650 predicted 565
3 SASI_Hs01_00226651 predicted 466
4 SASI_Hs01_00226652 predicted 404
5 SASI_Hs01_00226653 predicted 530
6 SASI_Hs01_00226654 predicted 390
7 SASI_Hs01_00226655 predicted 520
8 SASI_Hs01_00226656 predicted 391
9 SASI_Hs01_00226657 predicted 407
10 SASI_Hs01_00226658 predicted 377
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_042117 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00533209 predicted 448
2 SASI_Hs02_00533210 predicted 556
3 SASI_Hs02_00533211 predicted 452
4 SASI_Hs02_00533212 predicted 397
5 SASI_Hs02_00533213 predicted 531
6 SASI_Hs02_00533214 predicted 385
7 SASI_Hs02_00533215 predicted 379
8 SASI_Hs02_00533216 predicted 394
9 SASI_Hs02_00533217 predicted 371
10 SASI_Hs02_00533218 predicted 524
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_042118 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00533219 predicted 449
2 SASI_Hs02_00533220 predicted 558
3 SASI_Hs02_00533221 predicted 461
4 SASI_Hs02_00533222 predicted 391
5 SASI_Hs02_00533223 predicted 526
6 SASI_Hs02_00533224 predicted 386
7 SASI_Hs02_00533225 predicted 384
8 SASI_Hs02_00533226 predicted 395
9 SASI_Hs02_00533227 predicted 366
10 SASI_Hs02_00533228 predicted 518
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_042119 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00533229 predicted 451
2 SASI_Hs02_00533230 predicted 555
3 SASI_Hs02_00533231 predicted 459
4 SASI_Hs02_00533232 predicted 398
5 SASI_Hs02_00533233 predicted 523
6 SASI_Hs02_00533234 predicted 385
7 SASI_Hs02_00533235 predicted 508
8 SASI_Hs02_00533236 predicted 383
9 SASI_Hs02_00533237 predicted 370
10 SASI_Hs02_00533238 predicted 517
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001006606
LOC388882 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006606.1-154s1c1
Sequence:CCGGCTACCATGTTACAGGTGACTTCTCGAGAAGTCACCTGTAACATGGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128127    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001006606.1-988s1c1
Sequence:CCGGCTTATGATTTCTTCTCGGGTTCTCGAGAACCCGAGAAGAAATCATAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006606.1-530s1c1
Sequence:CCGGCTCTAACGATGCCGTAAACATCTCGAGATGTTTACGGCATCGTTAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006606.1-564s1c1
Sequence:CCGGGCTGTACGTGACATCTCTAATCTCGAGATTAGAGATGTCACGTACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127885    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001006606.1-1459s1c1
Sequence:CCGGCGACTGGAGACTTCATCCATACTCGAGTATGGATGAAGTCTCCAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001006606
LOC388882 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006606.1-154s1c1
Sequence:CCGGCTACCATGTTACAGGTGACTTCTCGAGAAGTCACCTGTAACATGGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128127    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001006606.1-988s1c1
Sequence:CCGGCTTATGATTTCTTCTCGGGTTCTCGAGAACCCGAGAAGAAATCATAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006606.1-530s1c1
Sequence:CCGGCTCTAACGATGCCGTAAACATCTCGAGATGTTTACGGCATCGTTAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006606.1-564s1c1
Sequence:CCGGGCTGTACGTGACATCTCTAATCTCGAGATTAGAGATGTCACGTACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127885    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001006606.1-1459s1c1
Sequence:CCGGCGACTGGAGACTTCATCCATACTCGAGTATGGATGAAGTCTCCAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001006606
LOC388882 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006606.1-154s1c1
Sequence:CCGGCTACCATGTTACAGGTGACTTCTCGAGAAGTCACCTGTAACATGGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128127    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001006606.1-988s1c1
Sequence:CCGGCTTATGATTTCTTCTCGGGTTCTCGAGAACCCGAGAAGAAATCATAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006606.1-530s1c1
Sequence:CCGGCTCTAACGATGCCGTAAACATCTCGAGATGTTTACGGCATCGTTAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006606.1-564s1c1
Sequence:CCGGGCTGTACGTGACATCTCTAATCTCGAGATTAGAGATGTCACGTACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127885    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001006606.1-1459s1c1
Sequence:CCGGCGACTGGAGACTTCATCCATACTCGAGTATGGATGAAGTCTCCAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)