EMAIL THIS PAGE TO A FRIEND

LOC389834

16 Gene Product Result for
Species: Human LOC389834(389834)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013655 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013655 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013655 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013655 Rosetta Predictions human pricing
XM_001726968 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013655 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159233 predicted 1885
2 SASI_Hs02_00306424 predicted 1890
3 SASI_Hs02_00306425 predicted 1896
4 SASI_Hs01_00159234 predicted 1813
5 SASI_Hs01_00159235 predicted 1957
6 SASI_Hs01_00159236 predicted 1953
7 SASI_Hs01_00159237 predicted 1544
8 SASI_Hs01_00159238 predicted 1847
9 SASI_Hs01_00159239 predicted 1967
10 SASI_Hs01_00159240 predicted 1637
11 SASI_Hs01_00159241 predicted 1623
12 SASI_Hs01_00159242 predicted 1976
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001726968 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00477748 predicted 666
2 SASI_Hs02_00477749 predicted 1063
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013655
LOC389834 MISSION shRNA Bacterial Glycerol Stock
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013655.1-1532s1c1
Sequence:CCGGGAAGCTGCTAGTGGGAACATACTCGAGTATGTTCCCACTAGCAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160285    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013655.1-3838s1c1
Sequence:CCGGCCTATGGTACTTTGAAATGAACTCGAGTTCATTTCAAAGTACCATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159358    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013655.1-3911s1c1
Sequence:CCGGGAGGTTTATATTCTGGGTATTCTCGAGAATACCCAGAATATAAACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013655.1-2051s1c1
Sequence:CCGGCTAAGGTTTGTCTTCTGAAATCTCGAGATTTCAGAAGACAAACCTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161414    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013655.1-2050s1c1
Sequence:CCGGGCTAAGGTTTGTCTTCTGAAACTCGAGTTTCAGAAGACAAACCTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162832    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013655.1-1962s1c1
Sequence:CCGGCGCTCTCTTAAAGTCCACTTACTCGAGTAAGTGGACTTTAAGAGAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163702    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013655.1-2653s1c1
Sequence:CCGGGCCATGCAAAGGAAGGAATATCTCGAGATATTCCTTCCTTTGCATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166767    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013655.1-3432s1c1
Sequence:CCGGCCCACTCTCCATGATGTGATTCTCGAGAATCACATCATGGAGAGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013655
LOC389834 MISSION shRNA shRNA Plasmid DNA
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013655.1-1532s1c1
Sequence:CCGGGAAGCTGCTAGTGGGAACATACTCGAGTATGTTCCCACTAGCAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160285    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013655.1-3838s1c1
Sequence:CCGGCCTATGGTACTTTGAAATGAACTCGAGTTCATTTCAAAGTACCATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159358    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013655.1-3911s1c1
Sequence:CCGGGAGGTTTATATTCTGGGTATTCTCGAGAATACCCAGAATATAAACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013655.1-2051s1c1
Sequence:CCGGCTAAGGTTTGTCTTCTGAAATCTCGAGATTTCAGAAGACAAACCTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161414    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013655.1-2050s1c1
Sequence:CCGGGCTAAGGTTTGTCTTCTGAAACTCGAGTTTCAGAAGACAAACCTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162832    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013655.1-1962s1c1
Sequence:CCGGCGCTCTCTTAAAGTCCACTTACTCGAGTAAGTGGACTTTAAGAGAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163702    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013655.1-2653s1c1
Sequence:CCGGGCCATGCAAAGGAAGGAATATCTCGAGATATTCCTTCCTTTGCATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166767    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013655.1-3432s1c1
Sequence:CCGGCCCACTCTCCATGATGTGATTCTCGAGAATCACATCATGGAGAGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013655
LOC389834 MISSION shRNA Lentiviral Transduction Particles
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013655.1-1532s1c1
Sequence:CCGGGAAGCTGCTAGTGGGAACATACTCGAGTATGTTCCCACTAGCAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160285    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013655.1-3838s1c1
Sequence:CCGGCCTATGGTACTTTGAAATGAACTCGAGTTCATTTCAAAGTACCATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159358    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013655.1-3911s1c1
Sequence:CCGGGAGGTTTATATTCTGGGTATTCTCGAGAATACCCAGAATATAAACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013655.1-2051s1c1
Sequence:CCGGCTAAGGTTTGTCTTCTGAAATCTCGAGATTTCAGAAGACAAACCTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161414    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013655.1-2050s1c1
Sequence:CCGGGCTAAGGTTTGTCTTCTGAAACTCGAGTTTCAGAAGACAAACCTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162832    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013655.1-1962s1c1
Sequence:CCGGCGCTCTCTTAAAGTCCACTTACTCGAGTAAGTGGACTTTAAGAGAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163702    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013655.1-2653s1c1
Sequence:CCGGGCCATGCAAAGGAAGGAATATCTCGAGATATTCCTTCCTTTGCATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166767    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013655.1-3432s1c1
Sequence:CCGGCCCACTCTCCATGATGTGATTCTCGAGAATCACATCATGGAGAGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)