EMAIL THIS PAGE TO A FRIEND

LOC389842

19 Gene Product Result for
Species: Human LOC389842(389842)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372200 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372200 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372200 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001715127 Rosetta Predictions human pricing
XM_372200 Rosetta Predictions human pricing
XM_942610 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715127 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00401644 predicted 491
2 SASI_Hs02_00401645 predicted 49
3 SASI_Hs02_00401646 predicted 435
4 SASI_Hs02_00401647 predicted 479
5 SASI_Hs02_00401648 predicted 421
6 SASI_Hs02_00401649 predicted 450
7 SASI_Hs02_00401650 predicted 434
8 SASI_Hs02_00401651 predicted 475
9 SASI_Hs02_00401652 predicted 495
10 SASI_Hs02_00401653 predicted 452
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_372200 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00264055 predicted 154
2 SASI_Hs01_00264059 predicted 659
3 SASI_Hs01_00264056 predicted 63
4 SASI_Hs01_00264057 predicted 142
5 SASI_Hs01_00264058 predicted 29
6 SASI_Hs01_00264060 predicted 78
7 SASI_Hs01_00264061 predicted 21
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_942610 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00485546 predicted 162
2 SASI_Hs02_00485547 predicted 659
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372200
LOC389842 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372200.2-527s1c1
Sequence:CCGGCGCTTCCTGAATGCTGAGAATCTCGAGATTCTCAGCATTCAGGAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372200.2-166s1c1
Sequence:CCGGGTTGAACCATGACCCTCAGTTCTCGAGAACTGAGGGTCATGGTTCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372200.2-335s1c1
Sequence:CCGGCTCCTGAAGCACAAGGAGAAACTCGAGTTTCTCCTTGTGCTTCAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372200.2-136s1c1
Sequence:CCGGCCATGATACTTCCACTGAGAACTCGAGTTCTCAGTGGAAGTATCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372200.2-179s1c1
Sequence:CCGGCCTCAGTTTGAGCCAATAGTTCTCGAGAACTATTGGCTCAAACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372200
LOC389842 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372200.2-527s1c1
Sequence:CCGGCGCTTCCTGAATGCTGAGAATCTCGAGATTCTCAGCATTCAGGAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372200.2-166s1c1
Sequence:CCGGGTTGAACCATGACCCTCAGTTCTCGAGAACTGAGGGTCATGGTTCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372200.2-335s1c1
Sequence:CCGGCTCCTGAAGCACAAGGAGAAACTCGAGTTTCTCCTTGTGCTTCAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372200.2-136s1c1
Sequence:CCGGCCATGATACTTCCACTGAGAACTCGAGTTCTCAGTGGAAGTATCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372200.2-179s1c1
Sequence:CCGGCCTCAGTTTGAGCCAATAGTTCTCGAGAACTATTGGCTCAAACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372200
LOC389842 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372200.2-527s1c1
Sequence:CCGGCGCTTCCTGAATGCTGAGAATCTCGAGATTCTCAGCATTCAGGAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372200.2-166s1c1
Sequence:CCGGGTTGAACCATGACCCTCAGTTCTCGAGAACTGAGGGTCATGGTTCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372200.2-335s1c1
Sequence:CCGGCTCCTGAAGCACAAGGAGAAACTCGAGTTTCTCCTTGTGCTTCAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372200.2-136s1c1
Sequence:CCGGCCATGATACTTCCACTGAGAACTCGAGTTCTCAGTGGAAGTATCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372200.2-179s1c1
Sequence:CCGGCCTCAGTTTGAGCCAATAGTTCTCGAGAACTATTGGCTCAAACTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)