EMAIL THIS PAGE TO A FRIEND

LOC389906

32 Gene Product Result for
Species: Human LOC389906(389906)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_928240 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_928240 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_928240 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001713861 Rosetta Predictions human pricing
XM_928240 Rosetta Predictions human pricing
XM_942518 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001713861 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00393406 predicted 213
2 SASI_Hs02_00393407 predicted 252
3 SASI_Hs02_00393408 predicted 259
4 SASI_Hs02_00393409 predicted 259
5 SASI_Hs02_00393410 predicted 248
6 SASI_Hs02_00393411 predicted 264
7 SASI_Hs02_00393412 predicted 263
8 SASI_Hs02_00393413 predicted 248
9 SASI_Hs02_00393414 predicted 1281
10 SASI_Hs02_00393415 predicted 232
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928240 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00480795 predicted 1055
2 SASI_Hs02_00480796 predicted 1034
3 SASI_Hs02_00480797 predicted 1061
4 SASI_Hs02_00480798 predicted 1058
5 SASI_Hs02_00480799 predicted 1035
6 SASI_Hs02_00480800 predicted 1060
7 SASI_Hs02_00480801 predicted 1053
8 SASI_Hs02_00480802 predicted 1056
9 SASI_Hs02_00480803 predicted 1056
10 SASI_Hs02_00480804 predicted 1029
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_942518 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00485478 predicted 1173
2 SASI_Hs02_00485479 predicted 1153
3 SASI_Hs02_00485480 predicted 1173
4 SASI_Hs02_00485481 predicted 1156
5 SASI_Hs02_00485482 predicted 1173
6 SASI_Hs02_00485483 predicted 1169
7 SASI_Hs02_00485484 predicted 1178
8 SASI_Hs02_00485485 predicted 1182
9 SASI_Hs02_00485486 predicted 1180
10 SASI_Hs02_00485487 predicted 1154
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_928240
LOC389906 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_928240.2-415s1c1
Sequence:CCGGGAAGGCGCATTGGCGTCTTGCCTCGAGGCAAGACGCCAATGCGCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_928240.2-59s1c1
Sequence:CCGGCCAAAGAAGTGAAGACGTGTCCTCGAGGACACGTCTTCACTTCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_928240.2-808s1c1
Sequence:CCGGCGCTTGCTTATACGCTGTTGGCTCGAGCCAACAGCGTATAAGCAAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_928240.2-783s1c1
Sequence:CCGGCTTGGCGAGAATGCAAAGAAGCTCGAGCTTCTTTGCATTCTCGCCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_928240.2-774s1c1
Sequence:CCGGCGTTGACCTCTTGGCGAGAATCTCGAGATTCTCGCCAAGAGGTCAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_928240
LOC389906 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_928240.2-415s1c1
Sequence:CCGGGAAGGCGCATTGGCGTCTTGCCTCGAGGCAAGACGCCAATGCGCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_928240.2-59s1c1
Sequence:CCGGCCAAAGAAGTGAAGACGTGTCCTCGAGGACACGTCTTCACTTCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_928240.2-808s1c1
Sequence:CCGGCGCTTGCTTATACGCTGTTGGCTCGAGCCAACAGCGTATAAGCAAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_928240.2-783s1c1
Sequence:CCGGCTTGGCGAGAATGCAAAGAAGCTCGAGCTTCTTTGCATTCTCGCCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_928240.2-774s1c1
Sequence:CCGGCGTTGACCTCTTGGCGAGAATCTCGAGATTCTCGCCAAGAGGTCAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_928240
LOC389906 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_928240.2-415s1c1
Sequence:CCGGGAAGGCGCATTGGCGTCTTGCCTCGAGGCAAGACGCCAATGCGCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_928240.2-59s1c1
Sequence:CCGGCCAAAGAAGTGAAGACGTGTCCTCGAGGACACGTCTTCACTTCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_928240.2-808s1c1
Sequence:CCGGCGCTTGCTTATACGCTGTTGGCTCGAGCCAACAGCGTATAAGCAAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_928240.2-783s1c1
Sequence:CCGGCTTGGCGAGAATGCAAAGAAGCTCGAGCTTCTTTGCATTCTCGCCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_928240.2-774s1c1
Sequence:CCGGCGTTGACCTCTTGGCGAGAATCTCGAGATTCTCGCCAAGAGGTCAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)