EMAIL THIS PAGE TO A FRIEND

LOC390705

22 Gene Product Result for
Species: Human LOC390705(390705)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372626 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372626 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372626 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_372626 Rosetta Predictions human pricing
XR_015850 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_372626 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00272527 predicted 1064
2 SASI_Hs01_00272528 predicted 1092
3 SASI_Hs01_00272529 predicted 1053
4 SASI_Hs01_00272530 predicted 1203
5 SASI_Hs01_00272531 predicted 1836
6 SASI_Hs01_00272532 predicted 1390
7 SASI_Hs01_00272533 predicted 1100
8 SASI_Hs01_00272534 predicted 1534
9 SASI_Hs01_00272535 predicted 1156
10 SASI_Hs01_00272536 predicted 1198
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_015850 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00489327 predicted 249
2 SASI_Hs02_00489328 predicted 297
3 SASI_Hs02_00489329 predicted 591
4 SASI_Hs02_00489330 predicted 237
5 SASI_Hs02_00489331 predicted 256
6 SASI_Hs02_00489332 predicted 455
7 SASI_Hs02_00489333 predicted 219
8 SASI_Hs02_00489334 predicted 280
9 SASI_Hs02_00489335 predicted 265
10 SASI_Hs02_00489336 predicted 301
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372626
LOC390705 MISSION shRNA Bacterial Glycerol Stock
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372626.1-219s1c2
Sequence:CCGGTGGCTGCGGAGCAGCCTGCATCTCGAGATGCAGGCTGCTCCGCAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372626.1-229s1c1
Sequence:CCGGGCAGCCTGCATTTCTCGGAAACTCGAGTTTCCGAGAAATGCAGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372626.1-300s1c1
Sequence:CCGGTCGTTGCAGGTTCGAGGCCGACTCGAGTCGGCCTCGAACCTGCAACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372626.1-219s1c1
Sequence:CCGGTGGCTGCGGAGCAGCCTGCATCTCGAGATGCAGGCTGCTCCGCAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372626.1-123s1c1
Sequence:CCGGCGCGTTGGTGGAGCCGGCTTTCTCGAGAAAGCCGGCTCCACCAACGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372626.1-275s1c1
Sequence:CCGGCGCTGTCCACGTCTTCACCATCTCGAGATGGTGAAGACGTGGACAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372626
LOC390705 MISSION shRNA shRNA Plasmid DNA
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372626.1-219s1c2
Sequence:CCGGTGGCTGCGGAGCAGCCTGCATCTCGAGATGCAGGCTGCTCCGCAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372626.1-229s1c1
Sequence:CCGGGCAGCCTGCATTTCTCGGAAACTCGAGTTTCCGAGAAATGCAGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372626.1-300s1c1
Sequence:CCGGTCGTTGCAGGTTCGAGGCCGACTCGAGTCGGCCTCGAACCTGCAACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372626.1-219s1c1
Sequence:CCGGTGGCTGCGGAGCAGCCTGCATCTCGAGATGCAGGCTGCTCCGCAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372626.1-123s1c1
Sequence:CCGGCGCGTTGGTGGAGCCGGCTTTCTCGAGAAAGCCGGCTCCACCAACGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372626.1-275s1c1
Sequence:CCGGCGCTGTCCACGTCTTCACCATCTCGAGATGGTGAAGACGTGGACAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372626
LOC390705 MISSION shRNA Lentiviral Transduction Particles
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372626.1-219s1c2
Sequence:CCGGTGGCTGCGGAGCAGCCTGCATCTCGAGATGCAGGCTGCTCCGCAGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372626.1-229s1c1
Sequence:CCGGGCAGCCTGCATTTCTCGGAAACTCGAGTTTCCGAGAAATGCAGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372626.1-300s1c1
Sequence:CCGGTCGTTGCAGGTTCGAGGCCGACTCGAGTCGGCCTCGAACCTGCAACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372626.1-219s1c1
Sequence:CCGGTGGCTGCGGAGCAGCCTGCATCTCGAGATGCAGGCTGCTCCGCAGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372626.1-123s1c1
Sequence:CCGGCGCGTTGGTGGAGCCGGCTTTCTCGAGAAAGCCGGCTCCACCAACGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372626.1-275s1c1
Sequence:CCGGCGCTGTCCACGTCTTCACCATCTCGAGATGGTGAAGACGTGGACAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)