EMAIL THIS PAGE TO A FRIEND

LOC390846

10 Gene Product Result for
Species: Human LOC390846(390846)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372693 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372693 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372693 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_372693 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_372693 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00261888 predicted 355
2 SASI_Hs01_00261889 predicted 359
3 SASI_Hs01_00261890 predicted 88
4 SASI_Hs01_00261891 predicted 43
5 SASI_Hs01_00261892 predicted 356
6 SASI_Hs01_00261893 predicted 89
7 SASI_Hs01_00261894 predicted 264
8 SASI_Hs01_00261895 predicted 297
9 SASI_Hs01_00261896 predicted 38
10 SASI_Hs01_00261897 predicted 141
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372693
LOC390846 MISSION shRNA Bacterial Glycerol Stock
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000203172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372693.1-211s1c1
Sequence:CCGGGACCAGTTTAAGTATGATGTTCTCGAGAACATCATACTTAAACTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372693.1-138s1c1
Sequence:CCGGCCATCTAGAACATCGGGAGATCTCGAGATCTCCCGATGTTCTAGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372693
LOC390846 MISSION shRNA shRNA Plasmid DNA
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000203172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372693.1-211s1c1
Sequence:CCGGGACCAGTTTAAGTATGATGTTCTCGAGAACATCATACTTAAACTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372693.1-138s1c1
Sequence:CCGGCCATCTAGAACATCGGGAGATCTCGAGATCTCCCGATGTTCTAGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372693
LOC390846 MISSION shRNA Lentiviral Transduction Particles
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000203172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372693.1-211s1c1
Sequence:CCGGGACCAGTTTAAGTATGATGTTCTCGAGAACATCATACTTAAACTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372693.1-138s1c1
Sequence:CCGGCCATCTAGAACATCGGGAGATCTCGAGATCTCCCGATGTTCTAGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)