EMAIL THIS PAGE TO A FRIEND

LOC390877

10 Gene Product Result for
Species: Human LOC390877(390877)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372705 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372705 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372705 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_372705 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_372705 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00254833 predicted 322
2 SASI_Hs01_00254834 predicted 273
3 SASI_Hs01_00254835 predicted 228
4 SASI_Hs01_00254836 predicted 270
5 SASI_Hs01_00254837 predicted 359
6 SASI_Hs01_00254838 predicted 325
7 SASI_Hs01_00254839 predicted 228
8 SASI_Hs01_00254840 predicted 280
9 SASI_Hs01_00254841 predicted 323
10 SASI_Hs01_00254842 predicted 359
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372705
LOC390877 MISSION shRNA Bacterial Glycerol Stock
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372705.3-262s1c1
Sequence:CCGGGCCATGGAGTTTGAGCGCATCCTCGAGGATGCGCTCAAACTCCATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372705.3-54s1c1
Sequence:CCGGGTACGGCTTCTGCCATGTGGGCTCGAGCCCACATGGCAGAAGCCGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372705.1-33s1c1
Sequence:CCGGGTGCAAGAATATGGCGACCAACTCGAGTTGGTCGCCATATTCTTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372705.1-177s1c1
Sequence:CCGGCCCAGATATGGTCAGTGACAACTCGAGTTGTCACTGACCATATCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372705.1-170s1c1
Sequence:CCGGGCATCATCCCAGATATGGTCACTCGAGTGACCATATCTGGGATGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372705.1-295s1c1
Sequence:CCGGCCCAGCGTCGTCATCGTGTTTCTCGAGAAACACGATGACGACGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372705.1-306s1c1
Sequence:CCGGCATCGTGTTTGACTGCTCCATCTCGAGATGGAGCAGTCAAACACGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372705.3-328s1c1
Sequence:CCGGGAGACGATGCTCCGACGAGTGCTCGAGCACTCGTCGGAGCATCGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372705
LOC390877 MISSION shRNA shRNA Plasmid DNA
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372705.3-262s1c1
Sequence:CCGGGCCATGGAGTTTGAGCGCATCCTCGAGGATGCGCTCAAACTCCATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372705.3-54s1c1
Sequence:CCGGGTACGGCTTCTGCCATGTGGGCTCGAGCCCACATGGCAGAAGCCGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372705.1-33s1c1
Sequence:CCGGGTGCAAGAATATGGCGACCAACTCGAGTTGGTCGCCATATTCTTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372705.1-177s1c1
Sequence:CCGGCCCAGATATGGTCAGTGACAACTCGAGTTGTCACTGACCATATCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372705.1-170s1c1
Sequence:CCGGGCATCATCCCAGATATGGTCACTCGAGTGACCATATCTGGGATGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372705.1-295s1c1
Sequence:CCGGCCCAGCGTCGTCATCGTGTTTCTCGAGAAACACGATGACGACGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372705.1-306s1c1
Sequence:CCGGCATCGTGTTTGACTGCTCCATCTCGAGATGGAGCAGTCAAACACGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372705.3-328s1c1
Sequence:CCGGGAGACGATGCTCCGACGAGTGCTCGAGCACTCGTCGGAGCATCGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372705
LOC390877 MISSION shRNA Lentiviral Transduction Particles
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372705.3-262s1c1
Sequence:CCGGGCCATGGAGTTTGAGCGCATCCTCGAGGATGCGCTCAAACTCCATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372705.3-54s1c1
Sequence:CCGGGTACGGCTTCTGCCATGTGGGCTCGAGCCCACATGGCAGAAGCCGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372705.1-33s1c1
Sequence:CCGGGTGCAAGAATATGGCGACCAACTCGAGTTGGTCGCCATATTCTTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372705.1-177s1c1
Sequence:CCGGCCCAGATATGGTCAGTGACAACTCGAGTTGTCACTGACCATATCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372705.1-170s1c1
Sequence:CCGGGCATCATCCCAGATATGGTCACTCGAGTGACCATATCTGGGATGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372705.1-295s1c1
Sequence:CCGGCCCAGCGTCGTCATCGTGTTTCTCGAGAAACACGATGACGACGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372705.1-306s1c1
Sequence:CCGGCATCGTGTTTGACTGCTCCATCTCGAGATGGAGCAGTCAAACACGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372705.3-328s1c1
Sequence:CCGGGAGACGATGCTCCGACGAGTGCTCGAGCACTCGTCGGAGCATCGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)