EMAIL THIS PAGE TO A FRIEND

LOC391092

Gene Product Result for
Species: Human LOC391092(391092)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372792
LOC391092 MISSION shRNA Bacterial Glycerol Stock
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372792.1-966s1c1
Sequence:CCGGCCCTCTGGAGAGTCTTAACAACTCGAGTTGTTAAGACTCTCCAGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372792.1-480s1c1
Sequence:CCGGGCCCACTTCAAATTTCGGAAACTCGAGTTTCCGAAATTTGAAGTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372792.1-699s1c1
Sequence:CCGGGCATCTGATTCATATCCTAATCTCGAGATTAGGATATGAATCAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372792.1-564s1c1
Sequence:CCGGGCTGAATAGAACAGGAAAGTTCTCGAGAACTTTCCTGTTCTATTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372792.1-901s1c1
Sequence:CCGGGCTCTGAAAGTTCTGTTGCATCTCGAGATGCAACAGAACTTTCAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372792.1-235s1c1
Sequence:CCGGCGAGCTATGCTGAAGAGACTTCTCGAGAAGTCTCTTCAGCATAGCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372792.1-143s1c1
Sequence:CCGGGCTGTGAGATTCTAAAGGCCACTCGAGTGGCCTTTAGAATCTCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372792
LOC391092 MISSION shRNA shRNA Plasmid DNA
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372792.1-966s1c1
Sequence:CCGGCCCTCTGGAGAGTCTTAACAACTCGAGTTGTTAAGACTCTCCAGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372792.1-480s1c1
Sequence:CCGGGCCCACTTCAAATTTCGGAAACTCGAGTTTCCGAAATTTGAAGTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372792.1-699s1c1
Sequence:CCGGGCATCTGATTCATATCCTAATCTCGAGATTAGGATATGAATCAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372792.1-564s1c1
Sequence:CCGGGCTGAATAGAACAGGAAAGTTCTCGAGAACTTTCCTGTTCTATTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372792.1-901s1c1
Sequence:CCGGGCTCTGAAAGTTCTGTTGCATCTCGAGATGCAACAGAACTTTCAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372792.1-235s1c1
Sequence:CCGGCGAGCTATGCTGAAGAGACTTCTCGAGAAGTCTCTTCAGCATAGCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372792.1-143s1c1
Sequence:CCGGGCTGTGAGATTCTAAAGGCCACTCGAGTGGCCTTTAGAATCTCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372792
LOC391092 MISSION shRNA Lentiviral Transduction Particles
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372792.1-966s1c1
Sequence:CCGGCCCTCTGGAGAGTCTTAACAACTCGAGTTGTTAAGACTCTCCAGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372792.1-480s1c1
Sequence:CCGGGCCCACTTCAAATTTCGGAAACTCGAGTTTCCGAAATTTGAAGTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372792.1-699s1c1
Sequence:CCGGGCATCTGATTCATATCCTAATCTCGAGATTAGGATATGAATCAGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372792.1-564s1c1
Sequence:CCGGGCTGAATAGAACAGGAAAGTTCTCGAGAACTTTCCTGTTCTATTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372792.1-901s1c1
Sequence:CCGGGCTCTGAAAGTTCTGTTGCATCTCGAGATGCAACAGAACTTTCAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372792.1-235s1c1
Sequence:CCGGCGAGCTATGCTGAAGAGACTTCTCGAGAAGTCTCTTCAGCATAGCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372792.1-143s1c1
Sequence:CCGGGCTGTGAGATTCTAAAGGCCACTCGAGTGGCCTTTAGAATCTCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)