EMAIL THIS PAGE TO A FRIEND

LOC391322

60 Gene Product Result for
Species: Human LOC391322(391322)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001144931 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001144931 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001144931 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001726091 Rosetta Predictions human pricing
XM_001726092 Rosetta Predictions human pricing
XM_001726974 Rosetta Predictions human pricing
XM_372900 Rosetta Predictions human pricing
XM_938538 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001726091 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00471923 predicted 365
2 SASI_Hs02_00471924 predicted 457
3 SASI_Hs02_00471925 predicted 415
4 SASI_Hs02_00471926 predicted 389
5 SASI_Hs02_00471927 predicted 391
6 SASI_Hs02_00471928 predicted 313
7 SASI_Hs02_00471929 predicted 121
8 SASI_Hs02_00471930 predicted 24
9 SASI_Hs02_00471931 predicted 359
10 SASI_Hs02_00471932 predicted 451
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001726092 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00471933 predicted 261
2 SASI_Hs02_00471934 predicted 336
3 SASI_Hs02_00471935 predicted 269
4 SASI_Hs02_00471936 predicted 338
5 SASI_Hs02_00471937 predicted 205
6 SASI_Hs02_00471938 predicted 324
7 SASI_Hs02_00471939 predicted 360
8 SASI_Hs02_00471940 predicted 199
9 SASI_Hs02_00471941 predicted 109
10 SASI_Hs02_00471942 predicted 368
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001726974 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00477783 predicted 263
2 SASI_Hs02_00477784 predicted 331
3 SASI_Hs02_00477785 predicted 266
4 SASI_Hs02_00477786 predicted 337
5 SASI_Hs02_00477787 predicted 208
6 SASI_Hs02_00477788 predicted 325
7 SASI_Hs02_00477789 predicted 359
8 SASI_Hs02_00477790 predicted 199
9 SASI_Hs02_00477791 predicted 112
10 SASI_Hs02_00477792 predicted 372
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_372900 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00479456 predicted 363
2 SASI_Hs02_00479457 predicted 456
3 SASI_Hs02_00479458 predicted 422
4 SASI_Hs02_00479459 predicted 395
5 SASI_Hs02_00479460 predicted 390
6 SASI_Hs02_00479461 predicted 308
7 SASI_Hs01_00270274 predicted 120
8 SASI_Hs01_00270276 predicted 27
9 SASI_Hs02_00479462 predicted 359
10 SASI_Hs02_00479463 predicted 458
11 SASI_Hs01_00270272 predicted 262
12 SASI_Hs01_00270273 predicted 253
13 SASI_Hs01_00270275 predicted 278
14 SASI_Hs01_00270277 predicted 287
15 SASI_Hs01_00270278 predicted 260
16 SASI_Hs01_00270279 predicted 418
17 SASI_Hs01_00270280 predicted 412
18 SASI_Hs01_00270281 predicted 233
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_938538 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00483174 predicted 361
2 SASI_Hs02_00483175 predicted 454
3 SASI_Hs02_00483176 predicted 421
4 SASI_Hs02_00483177 predicted 394
5 SASI_Hs02_00483178 predicted 394
6 SASI_Hs02_00483179 predicted 315
7 SASI_Hs02_00483180 predicted 115
8 SASI_Hs02_00483181 predicted 22
9 SASI_Hs02_00483182 predicted 358
10 SASI_Hs02_00483183 predicted 459
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001144931
LOC391322 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000338841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144931.1-358s21c1
Sequence:CCGGTCCATTCCTGCTAACAGTTTACTCGAGTAAACTGTTAGCAGGAATGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144931.1-117s21c1
Sequence:CCGGCAAACCTGCAGACCTTGTGAACTCGAGTTCACAAGGTCTGCAGGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144931.1-386s21c1
Sequence:CCGGACACCTAGGCAGGCCATTTAGCTCGAGCTAAATGGCCTGCCTAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144931.1-369s21c1
Sequence:CCGGTAACAGTTTAAAGCCAAACACCTCGAGGTGTTTGGCTTTAAACTGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144931.1-344s21c1
Sequence:CCGGCACAATCAGAGTACTCCATTCCTCGAGGAATGGAGTACTCTGATTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001144931
LOC391322 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000338841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144931.1-358s21c1
Sequence:CCGGTCCATTCCTGCTAACAGTTTACTCGAGTAAACTGTTAGCAGGAATGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144931.1-117s21c1
Sequence:CCGGCAAACCTGCAGACCTTGTGAACTCGAGTTCACAAGGTCTGCAGGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144931.1-386s21c1
Sequence:CCGGACACCTAGGCAGGCCATTTAGCTCGAGCTAAATGGCCTGCCTAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144931.1-369s21c1
Sequence:CCGGTAACAGTTTAAAGCCAAACACCTCGAGGTGTTTGGCTTTAAACTGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144931.1-344s21c1
Sequence:CCGGCACAATCAGAGTACTCCATTCCTCGAGGAATGGAGTACTCTGATTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001144931
LOC391322 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000338841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144931.1-358s21c1
Sequence:CCGGTCCATTCCTGCTAACAGTTTACTCGAGTAAACTGTTAGCAGGAATGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144931.1-117s21c1
Sequence:CCGGCAAACCTGCAGACCTTGTGAACTCGAGTTCACAAGGTCTGCAGGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144931.1-386s21c1
Sequence:CCGGACACCTAGGCAGGCCATTTAGCTCGAGCTAAATGGCCTGCCTAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144931.1-369s21c1
Sequence:CCGGTAACAGTTTAAAGCCAAACACCTCGAGGTGTTTGGCTTTAAACTGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144931.1-344s21c1
Sequence:CCGGCACAATCAGAGTACTCCATTCCTCGAGGAATGGAGTACTCTGATTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)