EMAIL THIS PAGE TO A FRIEND

LOC391359

30 Gene Product Result for
Species: Human LOC391359(391359)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372922 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372922 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372922 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001721740 Rosetta Predictions human pricing
XM_001723323 Rosetta Predictions human pricing
XM_001726802 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001721740 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00444742 predicted 130
2 SASI_Hs02_00444743 predicted 134
3 SASI_Hs02_00444744 predicted 136
4 SASI_Hs02_00444745 predicted 148
5 SASI_Hs02_00444746 predicted 148
6 SASI_Hs02_00444747 predicted 248
7 SASI_Hs02_00444748 predicted 132
8 SASI_Hs02_00444749 predicted 154
9 SASI_Hs02_00444750 predicted 14
10 SASI_Hs02_00444751 predicted 153
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001723323 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00454711 predicted 132
2 SASI_Hs02_00454712 predicted 130
3 SASI_Hs02_00454713 predicted 131
4 SASI_Hs02_00454714 predicted 139
5 SASI_Hs02_00454715 predicted 150
6 SASI_Hs02_00454716 predicted 239
7 SASI_Hs02_00454717 predicted 130
8 SASI_Hs02_00454718 predicted 156
9 SASI_Hs02_00454719 predicted 7
10 SASI_Hs02_00454720 predicted 155
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001726802 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00476591 predicted 131
2 SASI_Hs02_00476592 predicted 131
3 SASI_Hs02_00476593 predicted 134
4 SASI_Hs02_00476594 predicted 142
5 SASI_Hs02_00476595 predicted 145
6 SASI_Hs02_00476596 predicted 242
7 SASI_Hs02_00476597 predicted 133
8 SASI_Hs02_00476598 predicted 160
9 SASI_Hs02_00476599 predicted 9
10 SASI_Hs02_00476600 predicted 151
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372922
LOC391359 MISSION shRNA Bacterial Glycerol Stock
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372922.1-81s1c1
Sequence:CCGGCTGGTGGGTAGGAAATGAGTTCTCGAGAACTCATTTCCTACCCACCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372922.1-106s1c1
Sequence:CCGGGCAGATGTCTGGAGAATATGTCTCGAGACATATTCTCCAGACATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185107    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372922.1-146s1c1
Sequence:CCGGCAGTAATCAATGACAGCTTTACTCGAGTAAAGCTGTCATTGATTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372922.1-137s1c1
Sequence:CCGGCGAAGTGTACAGTAATCAATGCTCGAGCATTGATTACTGTACACTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372922.2-138s1c1
Sequence:CCGGGAAGTCCTCCATTTATACAGACTCGAGTCTGTATAAATGGAGGACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372922.1-135s1c1
Sequence:CCGGCACGAAGTGTACAGTAATCAACTCGAGTTGATTACTGTACACTTCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372922
LOC391359 MISSION shRNA shRNA Plasmid DNA
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372922.1-81s1c1
Sequence:CCGGCTGGTGGGTAGGAAATGAGTTCTCGAGAACTCATTTCCTACCCACCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372922.1-106s1c1
Sequence:CCGGGCAGATGTCTGGAGAATATGTCTCGAGACATATTCTCCAGACATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185107    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372922.1-146s1c1
Sequence:CCGGCAGTAATCAATGACAGCTTTACTCGAGTAAAGCTGTCATTGATTACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372922.1-137s1c1
Sequence:CCGGCGAAGTGTACAGTAATCAATGCTCGAGCATTGATTACTGTACACTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372922.2-138s1c1
Sequence:CCGGGAAGTCCTCCATTTATACAGACTCGAGTCTGTATAAATGGAGGACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372922.1-135s1c1
Sequence:CCGGCACGAAGTGTACAGTAATCAACTCGAGTTGATTACTGTACACTTCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372922
LOC391359 MISSION shRNA Lentiviral Transduction Particles
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372922.1-81s1c1
Sequence:CCGGCTGGTGGGTAGGAAATGAGTTCTCGAGAACTCATTTCCTACCCACCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187890    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372922.1-106s1c1
Sequence:CCGGGCAGATGTCTGGAGAATATGTCTCGAGACATATTCTCCAGACATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185107    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372922.1-146s1c1
Sequence:CCGGCAGTAATCAATGACAGCTTTACTCGAGTAAAGCTGTCATTGATTACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372922.1-137s1c1
Sequence:CCGGCGAAGTGTACAGTAATCAATGCTCGAGCATTGATTACTGTACACTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372922.2-138s1c1
Sequence:CCGGGAAGTCCTCCATTTATACAGACTCGAGTCTGTATAAATGGAGGACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372922.1-135s1c1
Sequence:CCGGCACGAAGTGTACAGTAATCAACTCGAGTTGATTACTGTACACTTCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)