EMAIL THIS PAGE TO A FRIEND

LOC391707

Gene Product Result for
Species: Human LOC391707(391707)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_373036
LOC391707 MISSION shRNA Bacterial Glycerol Stock
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000053094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373036.1-221s1c1
Sequence:CCGGCCAAGGCAATGGAACTCTGTTCTCGAGAACAGAGTTCCATTGCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373036.1-92s1c1
Sequence:CCGGGAGGTGGTCATGGGCAAAGAACTCGAGTTCTTTGCCCATGACCACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373036.1-226s1c1
Sequence:CCGGGCAATGGAACTCTGTTCAATACTCGAGTATTGAACAGAGTTCCATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373036.1-302s1c1
Sequence:CCGGCTGACAGCGATTTAGCAAATACTCGAGTATTTGCTAAATCGCTGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_373036
LOC391707 MISSION shRNA shRNA Plasmid DNA
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000053094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373036.1-221s1c1
Sequence:CCGGCCAAGGCAATGGAACTCTGTTCTCGAGAACAGAGTTCCATTGCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373036.1-92s1c1
Sequence:CCGGGAGGTGGTCATGGGCAAAGAACTCGAGTTCTTTGCCCATGACCACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373036.1-226s1c1
Sequence:CCGGGCAATGGAACTCTGTTCAATACTCGAGTATTGAACAGAGTTCCATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373036.1-302s1c1
Sequence:CCGGCTGACAGCGATTTAGCAAATACTCGAGTATTTGCTAAATCGCTGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_373036
LOC391707 MISSION shRNA Lentiviral Transduction Particles
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000053094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373036.1-221s1c1
Sequence:CCGGCCAAGGCAATGGAACTCTGTTCTCGAGAACAGAGTTCCATTGCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373036.1-92s1c1
Sequence:CCGGGAGGTGGTCATGGGCAAAGAACTCGAGTTCTTTGCCCATGACCACCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373036.1-226s1c1
Sequence:CCGGGCAATGGAACTCTGTTCAATACTCGAGTATTGAACAGAGTTCCATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373036.1-302s1c1
Sequence:CCGGCTGACAGCGATTTAGCAAATACTCGAGTATTTGCTAAATCGCTGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)