EMAIL THIS PAGE TO A FRIEND

LOC391722

30 Gene Product Result for
Species: Human LOC391722(391722)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_373042 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_373042 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_373042 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001717060 Rosetta Predictions human pricing
XM_373042 Rosetta Predictions human pricing
XM_940406 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717060 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00414769 predicted 572
2 SASI_Hs02_00414770 predicted 668
3 SASI_Hs02_00414771 predicted 334
4 SASI_Hs02_00414772 predicted 239
5 SASI_Hs02_00414773 predicted 583
6 SASI_Hs02_00414774 predicted 864
7 SASI_Hs02_00414775 predicted 506
8 SASI_Hs02_00414776 predicted 649
9 SASI_Hs02_00414777 predicted 392
10 SASI_Hs02_00414778 predicted 201
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_373042 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00255303 predicted 575
2 SASI_Hs01_00255304 predicted 672
3 SASI_Hs01_00255305 predicted 329
4 SASI_Hs01_00255306 predicted 236
5 SASI_Hs01_00255307 predicted 586
6 SASI_Hs01_00255308 predicted 862
7 SASI_Hs01_00255309 predicted 499
8 SASI_Hs01_00255310 predicted 652
9 SASI_Hs01_00255311 predicted 397
10 SASI_Hs01_00255312 predicted 194
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_940406 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00484189 predicted 573
2 SASI_Hs02_00484190 predicted 674
3 SASI_Hs02_00484191 predicted 334
4 SASI_Hs02_00484192 predicted 238
5 SASI_Hs02_00484193 predicted 581
6 SASI_Hs02_00484194 predicted 863
7 SASI_Hs02_00484195 predicted 501
8 SASI_Hs02_00484196 predicted 650
9 SASI_Hs02_00484197 predicted 399
10 SASI_Hs02_00484198 predicted 199
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_373042
LOC391722 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000188378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373042.1-500s1c1
Sequence:CCGGCAGGCACCATTCAGGAAGATTCTCGAGAATCTTCCTGAATGGTGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373042.1-155s1c1
Sequence:CCGGGCAACCACCATGTTGAGCAAACTCGAGTTTGCTCAACATGGTGGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373042.1-32s1c1
Sequence:CCGGGCACCAAAGGAATGCTTAGAACTCGAGTTCTAAGCATTCCTTTGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373042.1-393s1c1
Sequence:CCGGGCCCATTAACTTCACCATGTTCTCGAGAACATGGTGAAGTTAATGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373042.1-414s1c1
Sequence:CCGGGCTCGCCATGTTTGGTAAGAACTCGAGTTCTTACCAAACATGGCGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_373042
LOC391722 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000188378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373042.1-500s1c1
Sequence:CCGGCAGGCACCATTCAGGAAGATTCTCGAGAATCTTCCTGAATGGTGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373042.1-155s1c1
Sequence:CCGGGCAACCACCATGTTGAGCAAACTCGAGTTTGCTCAACATGGTGGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373042.1-32s1c1
Sequence:CCGGGCACCAAAGGAATGCTTAGAACTCGAGTTCTAAGCATTCCTTTGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373042.1-393s1c1
Sequence:CCGGGCCCATTAACTTCACCATGTTCTCGAGAACATGGTGAAGTTAATGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373042.1-414s1c1
Sequence:CCGGGCTCGCCATGTTTGGTAAGAACTCGAGTTCTTACCAAACATGGCGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_373042
LOC391722 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000188378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373042.1-500s1c1
Sequence:CCGGCAGGCACCATTCAGGAAGATTCTCGAGAATCTTCCTGAATGGTGCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373042.1-155s1c1
Sequence:CCGGGCAACCACCATGTTGAGCAAACTCGAGTTTGCTCAACATGGTGGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373042.1-32s1c1
Sequence:CCGGGCACCAAAGGAATGCTTAGAACTCGAGTTCTAAGCATTCCTTTGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373042.1-393s1c1
Sequence:CCGGGCCCATTAACTTCACCATGTTCTCGAGAACATGGTGAAGTTAATGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373042.1-414s1c1
Sequence:CCGGGCTCGCCATGTTTGGTAAGAACTCGAGTTCTTACCAAACATGGCGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)