EMAIL THIS PAGE TO A FRIEND

LOC391742

4 Gene Product Result for
Species: Human LOC391742(391742)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301875 ANTI-YE016 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_373056 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_373056 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_373056 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_941127 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_941127 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00484675 predicted 362
2 SASI_Hs02_00484676 predicted 359
3 SASI_Hs02_00484677 predicted 367
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_373056
LOC391742 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373056.1-112s1c1
Sequence:CCGGGACCTCACAGAAGGTGACAATCTCGAGATTGTCACCTTCTGTGAGGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373056.1-393s1c1
Sequence:CCGGCAAGGTCTTTGTTGGAGAGGTCTCGAGACCTCTCCAACAAAGACCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373056.1-291s1c1
Sequence:CCGGTCGCCGGTCAGCTTTCCCAAACTCGAGTTTGGGAAAGCTGACCGGCGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373056.1-370s1c1
Sequence:CCGGGCGATTGCCATGGCTGGAATACTCGAGTATTCCAGCCATGGCAATCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373056.1-355s1c1
Sequence:CCGGGTGTCTGAGAACGTGGCGATTCTCGAGAATCGCCACGTTCTCAGACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_373056
LOC391742 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373056.1-112s1c1
Sequence:CCGGGACCTCACAGAAGGTGACAATCTCGAGATTGTCACCTTCTGTGAGGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373056.1-393s1c1
Sequence:CCGGCAAGGTCTTTGTTGGAGAGGTCTCGAGACCTCTCCAACAAAGACCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373056.1-291s1c1
Sequence:CCGGTCGCCGGTCAGCTTTCCCAAACTCGAGTTTGGGAAAGCTGACCGGCGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373056.1-370s1c1
Sequence:CCGGGCGATTGCCATGGCTGGAATACTCGAGTATTCCAGCCATGGCAATCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373056.1-355s1c1
Sequence:CCGGGTGTCTGAGAACGTGGCGATTCTCGAGAATCGCCACGTTCTCAGACACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_373056
LOC391742 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373056.1-112s1c1
Sequence:CCGGGACCTCACAGAAGGTGACAATCTCGAGATTGTCACCTTCTGTGAGGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373056.1-393s1c1
Sequence:CCGGCAAGGTCTTTGTTGGAGAGGTCTCGAGACCTCTCCAACAAAGACCTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373056.1-291s1c1
Sequence:CCGGTCGCCGGTCAGCTTTCCCAAACTCGAGTTTGGGAAAGCTGACCGGCGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373056.1-370s1c1
Sequence:CCGGGCGATTGCCATGGCTGGAATACTCGAGTATTCCAGCCATGGCAATCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373056.1-355s1c1
Sequence:CCGGGTGTCTGAGAACGTGGCGATTCTCGAGAATCGCCACGTTCTCAGACACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)