EMAIL THIS PAGE TO A FRIEND

LOC392145

10 Gene Product Result for
Species: Human LOC392145(392145)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_373214 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_373214 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_373214 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001126313 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126313 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328417 predicted 206
2 SASI_Hs02_00328418 predicted 292
3 SASI_Hs02_00328419 predicted 256
4 SASI_Hs02_00328420 predicted 215
5 SASI_Hs02_00328421 predicted 226
6 SASI_Hs02_00328422 predicted 216
7 SASI_Hs02_00328423 predicted 233
8 SASI_Hs02_00328424 predicted 230
9 SASI_Hs02_00328425 predicted 283
10 SASI_Hs02_00328426 predicted 220
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_373214
LOC392145 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373214.1-49s1c1
Sequence:CCGGCTAGACACAGTCACGAACAGACTCGAGTCTGTTCGTGACTGTGTCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373214.1-87s1c1
Sequence:CCGGCCCTGTAGAAACCAACCGGCTCTCGAGAGCCGGTTGGTTTCTACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373214.1-342s1c1
Sequence:CCGGAGGCATGGAGATGAATGACTTCTCGAGAAGTCATTCATCTCCATGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373214.1-110s1c1
Sequence:CCGGCCTCCATGCCACCAACTCTAACTCGAGTTAGAGTTGGTGGCATGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373214.1-262s1c1
Sequence:CCGGGCCTCGGAGCTGCTGCTGGAACTCGAGTTCCAGCAGCAGCTCCGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_373214
LOC392145 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373214.1-49s1c1
Sequence:CCGGCTAGACACAGTCACGAACAGACTCGAGTCTGTTCGTGACTGTGTCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373214.1-87s1c1
Sequence:CCGGCCCTGTAGAAACCAACCGGCTCTCGAGAGCCGGTTGGTTTCTACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373214.1-342s1c1
Sequence:CCGGAGGCATGGAGATGAATGACTTCTCGAGAAGTCATTCATCTCCATGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373214.1-110s1c1
Sequence:CCGGCCTCCATGCCACCAACTCTAACTCGAGTTAGAGTTGGTGGCATGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373214.1-262s1c1
Sequence:CCGGGCCTCGGAGCTGCTGCTGGAACTCGAGTTCCAGCAGCAGCTCCGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_373214
LOC392145 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373214.1-49s1c1
Sequence:CCGGCTAGACACAGTCACGAACAGACTCGAGTCTGTTCGTGACTGTGTCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373214.1-87s1c1
Sequence:CCGGCCCTGTAGAAACCAACCGGCTCTCGAGAGCCGGTTGGTTTCTACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373214.1-342s1c1
Sequence:CCGGAGGCATGGAGATGAATGACTTCTCGAGAAGTCATTCATCTCCATGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373214.1-110s1c1
Sequence:CCGGCCTCCATGCCACCAACTCTAACTCGAGTTAGAGTTGGTGGCATGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373214.1-262s1c1
Sequence:CCGGGCCTCGGAGCTGCTGCTGGAACTCGAGTTCCAGCAGCAGCTCCGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)