EMAIL THIS PAGE TO A FRIEND

LOC392285

30 Gene Product Result for
Species: Human LOC392285(392285)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_373275 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_373275 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_373275 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_017134 Rosetta Predictions human pricing
XR_018419 Rosetta Predictions human pricing
XR_037700 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017134 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00492450 predicted 502
2 SASI_Hs02_00492451 predicted 502
3 SASI_Hs02_00492452 predicted 410
4 SASI_Hs02_00492453 predicted 517
5 SASI_Hs02_00492454 predicted 512
6 SASI_Hs02_00492455 predicted 506
7 SASI_Hs02_00492456 predicted 517
8 SASI_Hs02_00492457 predicted 505
9 SASI_Hs02_00492458 predicted 24
10 SASI_Hs02_00492459 predicted 5
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_018419 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00496074 predicted 545
2 SASI_Hs02_00496075 predicted 550
3 SASI_Hs02_00496076 predicted 461
4 SASI_Hs02_00496077 predicted 563
5 SASI_Hs02_00496078 predicted 556
6 SASI_Hs02_00496079 predicted 556
7 SASI_Hs02_00496080 predicted 557
8 SASI_Hs02_00496081 predicted 559
9 SASI_Hs02_00496082 predicted 64
10 SASI_Hs02_00496083 predicted 22
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_037700 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00502946 predicted 497
2 SASI_Hs02_00502947 predicted 498
3 SASI_Hs02_00502948 predicted 416
4 SASI_Hs02_00502949 predicted 515
5 SASI_Hs02_00502950 predicted 508
6 SASI_Hs02_00502951 predicted 515
7 SASI_Hs02_00502952 predicted 512
8 SASI_Hs02_00502953 predicted 507
9 SASI_Hs02_00502954 predicted 221
10 SASI_Hs02_00502955 predicted 222
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_373275
LOC392285 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373275.1-158s1c1
Sequence:CCGGCTGGAGAGAAAGGATTTGCTTCTCGAGAAGCAAATCCTTTCTCTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373275.1-228s1c1
Sequence:CCGGTGGTGACTTCACACATCATAACTCGAGTTATGATGTGTGAAGTCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373275.1-239s1c1
Sequence:CCGGCACATCATAATGGCACTGGCACTCGAGTGCCAGTGCCATTATGATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373275.1-91s1c1
Sequence:CCGGCGCGTCTCCTTGGAGCTGTTTCTCGAGAAACAGCTCCAAGGAGACGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373275.1-99s1c1
Sequence:CCGGCTTGGAGCTGTTTGCAGACAACTCGAGTTGTCTGCAAACAGCTCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_373275
LOC392285 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373275.1-158s1c1
Sequence:CCGGCTGGAGAGAAAGGATTTGCTTCTCGAGAAGCAAATCCTTTCTCTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373275.1-228s1c1
Sequence:CCGGTGGTGACTTCACACATCATAACTCGAGTTATGATGTGTGAAGTCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373275.1-239s1c1
Sequence:CCGGCACATCATAATGGCACTGGCACTCGAGTGCCAGTGCCATTATGATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373275.1-91s1c1
Sequence:CCGGCGCGTCTCCTTGGAGCTGTTTCTCGAGAAACAGCTCCAAGGAGACGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373275.1-99s1c1
Sequence:CCGGCTTGGAGCTGTTTGCAGACAACTCGAGTTGTCTGCAAACAGCTCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_373275
LOC392285 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373275.1-158s1c1
Sequence:CCGGCTGGAGAGAAAGGATTTGCTTCTCGAGAAGCAAATCCTTTCTCTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373275.1-228s1c1
Sequence:CCGGTGGTGACTTCACACATCATAACTCGAGTTATGATGTGTGAAGTCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373275.1-239s1c1
Sequence:CCGGCACATCATAATGGCACTGGCACTCGAGTGCCAGTGCCATTATGATGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373275.1-91s1c1
Sequence:CCGGCGCGTCTCCTTGGAGCTGTTTCTCGAGAAACAGCTCCAAGGAGACGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373275.1-99s1c1
Sequence:CCGGCTTGGAGCTGTTTGCAGACAACTCGAGTTGTCTGCAAACAGCTCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)