EMAIL THIS PAGE TO A FRIEND

LOC399898

Gene Product Result for
Species: Human LOC399898(399898)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013666
LOC399898 MISSION shRNA Bacterial Glycerol Stock
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013666.1-2343s1c1
Sequence:CCGGGCTCTTACTCATAAGCACCATCTCGAGATGGTGCTTATGAGTAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013666.1-2053s1c1
Sequence:CCGGGCAAAGCACAATGTAAGGGAACTCGAGTTCCCTTACATTGTGCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013666.1-2158s1c1
Sequence:CCGGGCACACTTACAGAAATGCAAACTCGAGTTTGCATTTCTGTAAGTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013666.1-2197s1c1
Sequence:CCGGGCAAGATTTCAGGTCCAGGAACTCGAGTTCCTGGACCTGAAATCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148914    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013666.1-2725s1c1
Sequence:CCGGCCAGGCAGAATGGCTATTATTCTCGAGAATAATAGCCATTCTGCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147600    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013666.1-3961s1c1
Sequence:CCGGGCCTCCTGTTTCAAGTTTATTCTCGAGAATAAACTTGAAACAGGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013666.1-3879s1c1
Sequence:CCGGCCAGTATTACCCTTTAGGAATCTCGAGATTCCTAAAGGGTAATACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013666.1-2054s1c1
Sequence:CCGGCAAAGCACAATGTAAGGGAATCTCGAGATTCCCTTACATTGTGCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013666
LOC399898 MISSION shRNA shRNA Plasmid DNA
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013666.1-2343s1c1
Sequence:CCGGGCTCTTACTCATAAGCACCATCTCGAGATGGTGCTTATGAGTAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013666.1-2053s1c1
Sequence:CCGGGCAAAGCACAATGTAAGGGAACTCGAGTTCCCTTACATTGTGCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013666.1-2158s1c1
Sequence:CCGGGCACACTTACAGAAATGCAAACTCGAGTTTGCATTTCTGTAAGTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013666.1-2197s1c1
Sequence:CCGGGCAAGATTTCAGGTCCAGGAACTCGAGTTCCTGGACCTGAAATCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148914    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013666.1-2725s1c1
Sequence:CCGGCCAGGCAGAATGGCTATTATTCTCGAGAATAATAGCCATTCTGCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147600    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013666.1-3961s1c1
Sequence:CCGGGCCTCCTGTTTCAAGTTTATTCTCGAGAATAAACTTGAAACAGGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013666.1-3879s1c1
Sequence:CCGGCCAGTATTACCCTTTAGGAATCTCGAGATTCCTAAAGGGTAATACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013666.1-2054s1c1
Sequence:CCGGCAAAGCACAATGTAAGGGAATCTCGAGATTCCCTTACATTGTGCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013666
LOC399898 MISSION shRNA Lentiviral Transduction Particles
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013666.1-2343s1c1
Sequence:CCGGGCTCTTACTCATAAGCACCATCTCGAGATGGTGCTTATGAGTAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013666.1-2053s1c1
Sequence:CCGGGCAAAGCACAATGTAAGGGAACTCGAGTTCCCTTACATTGTGCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013666.1-2158s1c1
Sequence:CCGGGCACACTTACAGAAATGCAAACTCGAGTTTGCATTTCTGTAAGTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013666.1-2197s1c1
Sequence:CCGGGCAAGATTTCAGGTCCAGGAACTCGAGTTCCTGGACCTGAAATCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148914    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013666.1-2725s1c1
Sequence:CCGGCCAGGCAGAATGGCTATTATTCTCGAGAATAATAGCCATTCTGCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147600    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013666.1-3961s1c1
Sequence:CCGGGCCTCCTGTTTCAAGTTTATTCTCGAGAATAAACTTGAAACAGGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013666.1-3879s1c1
Sequence:CCGGCCAGTATTACCCTTTAGGAATCTCGAGATTCCTAAAGGGTAATACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013666.1-2054s1c1
Sequence:CCGGCAAAGCACAATGTAAGGGAATCTCGAGATTCCCTTACATTGTGCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)