EMAIL THIS PAGE TO A FRIEND

LOC400464

30 Gene Product Result for
Species: Human LOC400464(400464)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013670 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013670 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013670 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013670 Rosetta Predictions human pricing
XR_041114 Rosetta Predictions human pricing
XR_041115 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013670 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102125 predicted 985
2 SASI_Hs01_00102126 predicted 980
3 SASI_Hs01_00102127 predicted 1022
4 SASI_Hs01_00102128 predicted 1038
5 SASI_Hs01_00102129 predicted 262
6 SASI_Hs01_00102130 predicted 990
7 SASI_Hs01_00102131 predicted 233
8 SASI_Hs01_00102132 predicted 269
9 SASI_Hs01_00102133 predicted 988
10 SASI_Hs01_00102134 predicted 1047
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041114 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00524785 predicted 498
2 SASI_Hs02_00524786 predicted 351
3 SASI_Hs02_00524787 predicted 443
4 SASI_Hs02_00524788 predicted 386
5 SASI_Hs02_00524789 predicted 467
6 SASI_Hs02_00524790 predicted 547
7 SASI_Hs02_00524791 predicted 498
8 SASI_Hs02_00524792 predicted 286
9 SASI_Hs02_00524793 predicted 484
10 SASI_Hs02_00524794 predicted 266
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041115 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00524795 predicted 701
2 SASI_Hs02_00524796 predicted 148
3 SASI_Hs02_00524797 predicted 225
4 SASI_Hs02_00524798 predicted 695
5 SASI_Hs02_00524799 predicted 250
6 SASI_Hs02_00524800 predicted 223
7 SASI_Hs02_00524801 predicted 256
8 SASI_Hs02_00524802 predicted 660
9 SASI_Hs02_00524803 predicted 253
10 SASI_Hs02_00524804 predicted 211
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013670
LOC400464 MISSION shRNA Bacterial Glycerol Stock
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168350    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013670.1-1574s1c1
Sequence:CCGGGCCTTTGTTTGTGCTGAAGTACTCGAGTACTTCAGCACAAACAAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167443    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013670.1-1052s1c1
Sequence:CCGGGATAGTAGATTTAAGCCAGTTCTCGAGAACTGGCTTAAATCTACTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167666    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013670.1-1702s1c1
Sequence:CCGGGAACCGTTGAAATAGGTACTTCTCGAGAAGTACCTATTTCAACGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013670.1-826s1c1
Sequence:CCGGCCTCATTCTTCAGTCAGGTTTCTCGAGAAACCTGACTGAAGAATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167326    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013670.1-921s1c1
Sequence:CCGGCCAGACATCTTTAATTAGCAACTCGAGTTGCTAATTAAAGATGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168774    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013670.1-1394s1c1
Sequence:CCGGGAGATGGAGTTTCACCATGTTCTCGAGAACATGGTGAAACTCCATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013670
LOC400464 MISSION shRNA shRNA Plasmid DNA
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168350    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013670.1-1574s1c1
Sequence:CCGGGCCTTTGTTTGTGCTGAAGTACTCGAGTACTTCAGCACAAACAAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167443    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013670.1-1052s1c1
Sequence:CCGGGATAGTAGATTTAAGCCAGTTCTCGAGAACTGGCTTAAATCTACTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167666    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013670.1-1702s1c1
Sequence:CCGGGAACCGTTGAAATAGGTACTTCTCGAGAAGTACCTATTTCAACGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013670.1-826s1c1
Sequence:CCGGCCTCATTCTTCAGTCAGGTTTCTCGAGAAACCTGACTGAAGAATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167326    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013670.1-921s1c1
Sequence:CCGGCCAGACATCTTTAATTAGCAACTCGAGTTGCTAATTAAAGATGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168774    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013670.1-1394s1c1
Sequence:CCGGGAGATGGAGTTTCACCATGTTCTCGAGAACATGGTGAAACTCCATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013670
LOC400464 MISSION shRNA Lentiviral Transduction Particles
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168350    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013670.1-1574s1c1
Sequence:CCGGGCCTTTGTTTGTGCTGAAGTACTCGAGTACTTCAGCACAAACAAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167443    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013670.1-1052s1c1
Sequence:CCGGGATAGTAGATTTAAGCCAGTTCTCGAGAACTGGCTTAAATCTACTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167666    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013670.1-1702s1c1
Sequence:CCGGGAACCGTTGAAATAGGTACTTCTCGAGAAGTACCTATTTCAACGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013670.1-826s1c1
Sequence:CCGGCCTCATTCTTCAGTCAGGTTTCTCGAGAAACCTGACTGAAGAATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167326    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013670.1-921s1c1
Sequence:CCGGCCAGACATCTTTAATTAGCAACTCGAGTTGCTAATTAAAGATGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168774    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013670.1-1394s1c1
Sequence:CCGGGAGATGGAGTTTCACCATGTTCTCGAGAACATGGTGAAACTCCATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)