EMAIL THIS PAGE TO A FRIEND

LOC400499

41 Gene Product Result for
Species: Human LOC400499(400499)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA042154 Anti-CTD-3088G3.8 antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013671 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013671 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013671 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013671 Rosetta Predictions human pricing
XR_041131 Rosetta Predictions human pricing
XR_041132 Rosetta Predictions human pricing
XR_041133 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013671 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130911 predicted 2859
2 SASI_Hs01_00130912 predicted 1848
3 SASI_Hs01_00130913 predicted 2357
4 SASI_Hs01_00130914 predicted 2268
5 SASI_Hs01_00130915 predicted 2552
6 SASI_Hs01_00130916 predicted 2645
7 SASI_Hs01_00130917 predicted 2263
8 SASI_Hs01_00130918 predicted 2536
9 SASI_Hs01_00130919 predicted 2845
10 SASI_Hs01_00130920 predicted 2614
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041131 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00524915 predicted 3432
2 SASI_Hs02_00524916 predicted 1050
3 SASI_Hs02_00524917 predicted 4444
4 SASI_Hs02_00524918 predicted 2794
5 SASI_Hs02_00524919 predicted 3226
6 SASI_Hs02_00524920 predicted 749
7 SASI_Hs02_00524921 predicted 4687
8 SASI_Hs02_00524922 predicted 1403
9 SASI_Hs02_00524923 predicted 4154
10 SASI_Hs02_00524924 predicted 5663
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041132 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00524925 predicted 3429
2 SASI_Hs02_00524926 predicted 1047
3 SASI_Hs02_00524927 predicted 4450
4 SASI_Hs02_00524928 predicted 2795
5 SASI_Hs02_00524929 predicted 3230
6 SASI_Hs02_00524930 predicted 746
7 SASI_Hs02_00524931 predicted 4690
8 SASI_Hs02_00524932 predicted 1409
9 SASI_Hs02_00524933 predicted 4156
10 SASI_Hs02_00524934 predicted 5667
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041133 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00524935 predicted 3424
2 SASI_Hs02_00524936 predicted 1052
3 SASI_Hs02_00524937 predicted 3200
4 SASI_Hs02_00524938 predicted 4450
5 SASI_Hs02_00524939 predicted 2796
6 SASI_Hs02_00524940 predicted 3231
7 SASI_Hs02_00524941 predicted 4684
8 SASI_Hs02_00524942 predicted 1403
9 SASI_Hs02_00524943 predicted 4152
10 SASI_Hs02_00524944 predicted 5668
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013671
LOC400499 MISSION shRNA Bacterial Glycerol Stock
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000140717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013671.1-2082s1c1
Sequence:CCGGGTGGGACAAGAACAGCAACAACTCGAGTTGTTGCTGTTCTTGTCCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013671.1-2980s1c1
Sequence:CCGGGAGACTAGGGTTGTCCTGAATCTCGAGATTCAGGACAACCCTAGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013671.1-2350s1c1
Sequence:CCGGGAAGGAGTCTTGAACCTGGATCTCGAGATCCAGGTTCAAGACTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013671.1-2356s1c1
Sequence:CCGGGTCTTGAACCTGGATAGTCCACTCGAGTGGACTATCCAGGTTCAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013671.1-3075s1c1
Sequence:CCGGGCATCCATACGATGGCAAAGTCTCGAGACTTTGCCATCGTATGGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013671.1-2079s1c1
Sequence:CCGGGCAGTGGGACAAGAACAGCAACTCGAGTTGCTGTTCTTGTCCCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013671.1-2120s1c1
Sequence:CCGGGCCAGACCTTCAAGAATGACTCTCGAGAGTCATTCTTGAAGGTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013671.1-2091s1c1
Sequence:CCGGGAACAGCAACAAGAGGCATCTCTCGAGAGATGCCTCTTGTTGCTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013671.1-3072s1c1
Sequence:CCGGGATGCATCCATACGATGGCAACTCGAGTTGCCATCGTATGGATGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013671.1-3120s1c1
Sequence:CCGGCCTGGTTACTTGGAATCAGCACTCGAGTGCTGATTCCAAGTAACCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013671.1-2154s1c1
Sequence:CCGGGAGCAATCACTTCATGGAGTTCTCGAGAACTCCATGAAGTGATTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013671.1-2847s1c1
Sequence:CCGGGAGGCAAGACAGGACATTGTACTCGAGTACAATGTCCTGTCTTGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013671
LOC400499 MISSION shRNA shRNA Plasmid DNA
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000140717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013671.1-2082s1c1
Sequence:CCGGGTGGGACAAGAACAGCAACAACTCGAGTTGTTGCTGTTCTTGTCCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013671.1-2980s1c1
Sequence:CCGGGAGACTAGGGTTGTCCTGAATCTCGAGATTCAGGACAACCCTAGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013671.1-2350s1c1
Sequence:CCGGGAAGGAGTCTTGAACCTGGATCTCGAGATCCAGGTTCAAGACTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013671.1-2356s1c1
Sequence:CCGGGTCTTGAACCTGGATAGTCCACTCGAGTGGACTATCCAGGTTCAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013671.1-3075s1c1
Sequence:CCGGGCATCCATACGATGGCAAAGTCTCGAGACTTTGCCATCGTATGGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013671.1-2079s1c1
Sequence:CCGGGCAGTGGGACAAGAACAGCAACTCGAGTTGCTGTTCTTGTCCCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013671.1-2120s1c1
Sequence:CCGGGCCAGACCTTCAAGAATGACTCTCGAGAGTCATTCTTGAAGGTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013671.1-2091s1c1
Sequence:CCGGGAACAGCAACAAGAGGCATCTCTCGAGAGATGCCTCTTGTTGCTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013671.1-3072s1c1
Sequence:CCGGGATGCATCCATACGATGGCAACTCGAGTTGCCATCGTATGGATGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013671.1-3120s1c1
Sequence:CCGGCCTGGTTACTTGGAATCAGCACTCGAGTGCTGATTCCAAGTAACCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013671.1-2154s1c1
Sequence:CCGGGAGCAATCACTTCATGGAGTTCTCGAGAACTCCATGAAGTGATTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013671.1-2847s1c1
Sequence:CCGGGAGGCAAGACAGGACATTGTACTCGAGTACAATGTCCTGTCTTGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013671
LOC400499 MISSION shRNA Lentiviral Transduction Particles
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000140717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013671.1-2082s1c1
Sequence:CCGGGTGGGACAAGAACAGCAACAACTCGAGTTGTTGCTGTTCTTGTCCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013671.1-2980s1c1
Sequence:CCGGGAGACTAGGGTTGTCCTGAATCTCGAGATTCAGGACAACCCTAGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013671.1-2350s1c1
Sequence:CCGGGAAGGAGTCTTGAACCTGGATCTCGAGATCCAGGTTCAAGACTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013671.1-2356s1c1
Sequence:CCGGGTCTTGAACCTGGATAGTCCACTCGAGTGGACTATCCAGGTTCAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013671.1-3075s1c1
Sequence:CCGGGCATCCATACGATGGCAAAGTCTCGAGACTTTGCCATCGTATGGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013671.1-2079s1c1
Sequence:CCGGGCAGTGGGACAAGAACAGCAACTCGAGTTGCTGTTCTTGTCCCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013671.1-2120s1c1
Sequence:CCGGGCCAGACCTTCAAGAATGACTCTCGAGAGTCATTCTTGAAGGTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013671.1-2091s1c1
Sequence:CCGGGAACAGCAACAAGAGGCATCTCTCGAGAGATGCCTCTTGTTGCTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013671.1-3072s1c1
Sequence:CCGGGATGCATCCATACGATGGCAACTCGAGTTGCCATCGTATGGATGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013671.1-3120s1c1
Sequence:CCGGCCTGGTTACTTGGAATCAGCACTCGAGTGCTGATTCCAAGTAACCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013671.1-2154s1c1
Sequence:CCGGGAGCAATCACTTCATGGAGTTCTCGAGAACTCCATGAAGTGATTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013671.1-2847s1c1
Sequence:CCGGGAGGCAAGACAGGACATTGTACTCGAGTACAATGTCCTGTCTTGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)