EMAIL THIS PAGE TO A FRIEND

LOC400682

40 Gene Product Result for
Species: Human LOC400682(400682)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_001726878 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001726878 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001726878 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001726878 Rosetta Predictions human pricing
XM_001726991 Rosetta Predictions human pricing
XM_001732878 Rosetta Predictions human pricing
XM_375590 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001726878 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00477110 predicted 780
2 SASI_Hs02_00477111 predicted 778
3 SASI_Hs02_00477112 predicted 440
4 SASI_Hs02_00477113 predicted 615
5 SASI_Hs02_00477114 predicted 625
6 SASI_Hs02_00477115 predicted 708
7 SASI_Hs02_00477116 predicted 431
8 SASI_Hs02_00477117 predicted 428
9 SASI_Hs02_00477118 predicted 608
10 SASI_Hs02_00477119 predicted 508
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001726991 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00477885 predicted 1642
2 SASI_Hs02_00477886 predicted 1103
3 SASI_Hs02_00477887 predicted 1637
4 SASI_Hs02_00477888 predicted 860
5 SASI_Hs02_00477889 predicted 574
6 SASI_Hs02_00477890 predicted 1301
7 SASI_Hs02_00477891 predicted 1464
8 SASI_Hs02_00477892 predicted 1289
9 SASI_Hs02_00477893 predicted 1562
10 SASI_Hs02_00477894 predicted 1069
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001732878 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00478548 predicted 1734
2 SASI_Hs02_00478549 predicted 1190
3 SASI_Hs02_00478550 predicted 1730
4 SASI_Hs02_00478551 predicted 959
5 SASI_Hs02_00478552 predicted 672
6 SASI_Hs02_00478553 predicted 1390
7 SASI_Hs02_00478554 predicted 1563
8 SASI_Hs02_00478555 predicted 1389
9 SASI_Hs02_00478556 predicted 1656
10 SASI_Hs02_00478557 predicted 1168
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_375590 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00249202 predicted 785
2 SASI_Hs01_00249203 predicted 784
3 SASI_Hs01_00249204 predicted 446
4 SASI_Hs01_00249205 predicted 608
5 SASI_Hs01_00249206 predicted 621
6 SASI_Hs01_00249207 predicted 701
7 SASI_Hs01_00249208 predicted 434
8 SASI_Hs01_00249209 predicted 429
9 SASI_Hs01_00249210 predicted 605
10 SASI_Hs01_00249211 predicted 504
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001726878
LOC400682 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001726878.1-620s21c1
Sequence:CCGGTCACACCTCACTACACATAGACTCGAGTCTATGTGTAGTGAGGTGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001726878.1-437s21c1
Sequence:GTACCGGACCTTCAACTGCTTCTCAATTCTCGAGAATTGAGAAGCAGTTGAAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231000    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001726878.1-2209s21c1
Sequence:CCGGGAGTTAAGTGTTCAGTCATATCTCGAGATATGACTGAACACTTAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001726878.1-778s21c1
Sequence:CCGGTGCAAGATTCTCATACCTTAACTCGAGTTAAGGTATGAGAATCTTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001726878.1-865s21c1
Sequence:CCGGCCACTCCTCAACTCCTACTACCTCGAGGTAGTAGGAGTTGAGGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001726878
LOC400682 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001726878.1-620s21c1
Sequence:CCGGTCACACCTCACTACACATAGACTCGAGTCTATGTGTAGTGAGGTGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001726878.1-437s21c1
Sequence:GTACCGGACCTTCAACTGCTTCTCAATTCTCGAGAATTGAGAAGCAGTTGAAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231000    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001726878.1-2209s21c1
Sequence:CCGGGAGTTAAGTGTTCAGTCATATCTCGAGATATGACTGAACACTTAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001726878.1-778s21c1
Sequence:CCGGTGCAAGATTCTCATACCTTAACTCGAGTTAAGGTATGAGAATCTTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001726878.1-865s21c1
Sequence:CCGGCCACTCCTCAACTCCTACTACCTCGAGGTAGTAGGAGTTGAGGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001726878
LOC400682 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001726878.1-620s21c1
Sequence:CCGGTCACACCTCACTACACATAGACTCGAGTCTATGTGTAGTGAGGTGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001726878.1-437s21c1
Sequence:GTACCGGACCTTCAACTGCTTCTCAATTCTCGAGAATTGAGAAGCAGTTGAAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231000    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001726878.1-2209s21c1
Sequence:CCGGGAGTTAAGTGTTCAGTCATATCTCGAGATATGACTGAACACTTAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001726878.1-778s21c1
Sequence:CCGGTGCAAGATTCTCATACCTTAACTCGAGTTAAGGTATGAGAATCTTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001726878.1-865s21c1
Sequence:CCGGCCACTCCTCAACTCCTACTACCTCGAGGTAGTAGGAGTTGAGGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)