EMAIL THIS PAGE TO A FRIEND

LOC400707

47 Gene Product Result for
Species: Human LOC400707(400707)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013673 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013673 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013673 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013673 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013673 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057203 predicted 1025
2 SASI_Hs01_00057204 predicted 735
3 SASI_Hs01_00057205 predicted 729
4 SASI_Hs01_00057206 predicted 432
5 SASI_Hs01_00057207 predicted 715
6 SASI_Hs01_00057208 predicted 1047
7 SASI_Hs01_00057209 predicted 441
8 SASI_Hs01_00057210 predicted 316
9 SASI_Hs01_00057211 predicted 1053
10 SASI_Hs01_00057212 predicted 949
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013673
LOC400707 MISSION shRNA Bacterial Glycerol Stock
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164835    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013673.1-788s1c1
Sequence:CCGGCAAAGCCTTCATGTGTCGCAACTCGAGTTGCGACACATGAAGGCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163866    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013673.1-776s1c1
Sequence:CCGGCTTCTCGTTCATCAAAGCCTTCTCGAGAAGGCTTTGATGAACGAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158416    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013673.1-1729s1c1
Sequence:CCGGCAGGATTATATAGGCCTAAATCTCGAGATTTAGGCCTATATAATCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162612    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013673.1-1572s1c1
Sequence:CCGGCCACTTTCATTAACCAGCAAACTCGAGTTTGCTGGTTAATGAAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013673.1-163s1c1
Sequence:CCGGCTTTCTTCGATTTGTCGGTGACTCGAGTCACCGACAAATCGAAGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013673.1-444s1c1
Sequence:CCGGCTGTTGCGTCTGGTTCTGTTTCTCGAGAAACAGAACCAGACGCAACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013673
LOC400707 MISSION shRNA shRNA Plasmid DNA
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164835    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013673.1-788s1c1
Sequence:CCGGCAAAGCCTTCATGTGTCGCAACTCGAGTTGCGACACATGAAGGCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163866    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013673.1-776s1c1
Sequence:CCGGCTTCTCGTTCATCAAAGCCTTCTCGAGAAGGCTTTGATGAACGAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158416    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013673.1-1729s1c1
Sequence:CCGGCAGGATTATATAGGCCTAAATCTCGAGATTTAGGCCTATATAATCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162612    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013673.1-1572s1c1
Sequence:CCGGCCACTTTCATTAACCAGCAAACTCGAGTTTGCTGGTTAATGAAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013673.1-163s1c1
Sequence:CCGGCTTTCTTCGATTTGTCGGTGACTCGAGTCACCGACAAATCGAAGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013673.1-444s1c1
Sequence:CCGGCTGTTGCGTCTGGTTCTGTTTCTCGAGAAACAGAACCAGACGCAACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013673
LOC400707 MISSION shRNA Lentiviral Transduction Particles
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164835    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013673.1-788s1c1
Sequence:CCGGCAAAGCCTTCATGTGTCGCAACTCGAGTTGCGACACATGAAGGCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163866    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013673.1-776s1c1
Sequence:CCGGCTTCTCGTTCATCAAAGCCTTCTCGAGAAGGCTTTGATGAACGAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158416    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013673.1-1729s1c1
Sequence:CCGGCAGGATTATATAGGCCTAAATCTCGAGATTTAGGCCTATATAATCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162612    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013673.1-1572s1c1
Sequence:CCGGCCACTTTCATTAACCAGCAAACTCGAGTTTGCTGGTTAATGAAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013673.1-163s1c1
Sequence:CCGGCTTTCTTCGATTTGTCGGTGACTCGAGTCACCGACAAATCGAAGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013673.1-444s1c1
Sequence:CCGGCTGTTGCGTCTGGTTCTGTTTCTCGAGAAACAGAACCAGACGCAACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)