EMAIL THIS PAGE TO A FRIEND

LOC400891

78 Gene Product Result for
Species: Human LOC400891(400891)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013675 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013675 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013675 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013675 Rosetta Predictions human pricing
XR_041652 Rosetta Predictions human pricing
XR_041653 Rosetta Predictions human pricing
XR_041654 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013675 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221108 predicted 310
2 SASI_Hs01_00221109 predicted 208
3 SASI_Hs01_00221110 predicted 312
4 SASI_Hs01_00221111 predicted 307
5 SASI_Hs01_00221112 predicted 710
6 SASI_Hs01_00221113 predicted 2271
7 SASI_Hs01_00221114 predicted 2078
8 SASI_Hs01_00221115 predicted 2039
9 SASI_Hs01_00221116 predicted 1896
10 SASI_Hs01_00221117 predicted 1035
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041652 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00529239 predicted 1946
2 SASI_Hs02_00529240 predicted 1686
3 SASI_Hs02_00529241 predicted 1625
4 SASI_Hs02_00529242 predicted 1777
5 SASI_Hs02_00529243 predicted 1613
6 SASI_Hs02_00529244 predicted 326
7 SASI_Hs02_00529245 predicted 1943
8 SASI_Hs02_00529246 predicted 1894
9 SASI_Hs02_00529247 predicted 1691
10 SASI_Hs02_00529248 predicted 1693
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041653 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00529249 predicted 1947
2 SASI_Hs02_00529250 predicted 1686
3 SASI_Hs02_00529251 predicted 1618
4 SASI_Hs02_00529252 predicted 1773
5 SASI_Hs02_00529253 predicted 1618
6 SASI_Hs02_00529254 predicted 323
7 SASI_Hs02_00529255 predicted 1943
8 SASI_Hs02_00529256 predicted 1894
9 SASI_Hs02_00529257 predicted 1684
10 SASI_Hs02_00529258 predicted 1692
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041654 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00529259 predicted 1948
2 SASI_Hs02_00529260 predicted 1684
3 SASI_Hs02_00529261 predicted 1624
4 SASI_Hs02_00529262 predicted 1778
5 SASI_Hs02_00529263 predicted 1617
6 SASI_Hs02_00529264 predicted 322
7 SASI_Hs02_00529265 predicted 1945
8 SASI_Hs02_00529266 predicted 1888
9 SASI_Hs02_00529267 predicted 1683
10 SASI_Hs02_00529268 predicted 1693
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013675
LOC400891 MISSION shRNA Bacterial Glycerol Stock
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000162989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013675.1-34s1c1
Sequence:CCGGGAGGATGAAGAGCAGAAAGAACTCGAGTTCTTTCTGCTCTTCATCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013675.1-1816s1c1
Sequence:CCGGGCAAACATCTTCCTTAAAGTTCTCGAGAACTTTAAGGAAGATGTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013675.1-304s1c1
Sequence:CCGGGCTTCCTCATTGAGCTCCAATCTCGAGATTGGAGCTCAATGAGGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204114    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013675.1-2550s1c1
Sequence:CCGGGCTTGCAGAGTGGAGTATAAACTCGAGTTTATACTCCACTCTGCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013675.1-45s1c1
Sequence:CCGGGCAGAAAGAAGAGGCTATGGTCTCGAGACCATAGCCTCTTCTTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013675.1-1987s1c1
Sequence:CCGGCCTCCCAAAGTGCTGGAATTACTCGAGTAATTCCAGCACTTTGGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160317    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013675.1-2724s1c1
Sequence:CCGGCGAATATCCATAGCAACATTACTCGAGTAATGTTGCTATGGATATTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013675.1-321s1c1
Sequence:CCGGCAATCCATATGTCAAGCGGCTCTCGAGAGCCGCTTGACATATGGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013675
LOC400891 MISSION shRNA shRNA Plasmid DNA
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000162989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013675.1-34s1c1
Sequence:CCGGGAGGATGAAGAGCAGAAAGAACTCGAGTTCTTTCTGCTCTTCATCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013675.1-1816s1c1
Sequence:CCGGGCAAACATCTTCCTTAAAGTTCTCGAGAACTTTAAGGAAGATGTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013675.1-304s1c1
Sequence:CCGGGCTTCCTCATTGAGCTCCAATCTCGAGATTGGAGCTCAATGAGGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204114    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013675.1-2550s1c1
Sequence:CCGGGCTTGCAGAGTGGAGTATAAACTCGAGTTTATACTCCACTCTGCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013675.1-45s1c1
Sequence:CCGGGCAGAAAGAAGAGGCTATGGTCTCGAGACCATAGCCTCTTCTTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013675.1-1987s1c1
Sequence:CCGGCCTCCCAAAGTGCTGGAATTACTCGAGTAATTCCAGCACTTTGGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160317    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013675.1-2724s1c1
Sequence:CCGGCGAATATCCATAGCAACATTACTCGAGTAATGTTGCTATGGATATTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013675.1-321s1c1
Sequence:CCGGCAATCCATATGTCAAGCGGCTCTCGAGAGCCGCTTGACATATGGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013675
LOC400891 MISSION shRNA Lentiviral Transduction Particles
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000162989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013675.1-34s1c1
Sequence:CCGGGAGGATGAAGAGCAGAAAGAACTCGAGTTCTTTCTGCTCTTCATCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013675.1-1816s1c1
Sequence:CCGGGCAAACATCTTCCTTAAAGTTCTCGAGAACTTTAAGGAAGATGTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013675.1-304s1c1
Sequence:CCGGGCTTCCTCATTGAGCTCCAATCTCGAGATTGGAGCTCAATGAGGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204114    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013675.1-2550s1c1
Sequence:CCGGGCTTGCAGAGTGGAGTATAAACTCGAGTTTATACTCCACTCTGCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013675.1-45s1c1
Sequence:CCGGGCAGAAAGAAGAGGCTATGGTCTCGAGACCATAGCCTCTTCTTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013675.1-1987s1c1
Sequence:CCGGCCTCCCAAAGTGCTGGAATTACTCGAGTAATTCCAGCACTTTGGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160317    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013675.1-2724s1c1
Sequence:CCGGCGAATATCCATAGCAACATTACTCGAGTAATGTTGCTATGGATATTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013675.1-321s1c1
Sequence:CCGGCAATCCATATGTCAAGCGGCTCTCGAGAGCCGCTTGACATATGGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)