EMAIL THIS PAGE TO A FRIEND

LOC400940

43 Gene Product Result for
Species: Human LOC400940(400940)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207479 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207479 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207479 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207479 Rosetta Predictions human pricing
XR_041680 Rosetta Predictions human pricing
XR_041681 Rosetta Predictions human pricing
XR_041682 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207479 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090923 predicted 1402
2 SASI_Hs01_00090924 predicted 1338
3 SASI_Hs01_00090925 predicted 1259
4 SASI_Hs01_00090926 predicted 773
5 SASI_Hs01_00090927 predicted 1207
6 SASI_Hs01_00090928 predicted 1003
7 SASI_Hs01_00090929 predicted 1196
8 SASI_Hs01_00090930 predicted 1380
9 SASI_Hs01_00090931 predicted 949
10 SASI_Hs01_00090932 predicted 1275
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041680 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00529519 predicted 1025
2 SASI_Hs02_00529520 predicted 1220
3 SASI_Hs02_00529521 predicted 972
4 SASI_Hs02_00529522 predicted 782
5 SASI_Hs02_00529523 predicted 408
6 SASI_Hs02_00529524 predicted 1212
7 SASI_Hs02_00529525 predicted 200
8 SASI_Hs02_00529526 predicted 634
9 SASI_Hs02_00529527 predicted 355
10 SASI_Hs02_00529528 predicted 1007
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041681 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00529529 predicted 1028
2 SASI_Hs02_00529530 predicted 1224
3 SASI_Hs02_00529531 predicted 978
4 SASI_Hs02_00529532 predicted 779
5 SASI_Hs02_00529533 predicted 405
6 SASI_Hs02_00529534 predicted 1207
7 SASI_Hs02_00529535 predicted 209
8 SASI_Hs02_00529536 predicted 626
9 SASI_Hs02_00529537 predicted 350
10 SASI_Hs02_00529538 predicted 1014
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041682 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00529539 predicted 1032
2 SASI_Hs02_00529540 predicted 1222
3 SASI_Hs02_00529541 predicted 977
4 SASI_Hs02_00529542 predicted 780
5 SASI_Hs02_00529543 predicted 405
6 SASI_Hs02_00529544 predicted 1203
7 SASI_Hs02_00529545 predicted 205
8 SASI_Hs02_00529546 predicted 625
9 SASI_Hs02_00529547 predicted 350
10 SASI_Hs02_00529548 predicted 1010
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207479
LOC400940 MISSION shRNA Bacterial Glycerol Stock
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000167958    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207479.1-1575s1c1
Sequence:CCGGCCCATAGAATAATAGAGGGAACTCGAGTTCCCTCTATTATTCTATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172332    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207479.1-1108s1c1
Sequence:CCGGCCAAATGGGTTGACTCTGGATCTCGAGATCCAGAGTCAACCCATTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207479.1-1020s1c1
Sequence:CCGGCGGCTAATTTCCATCCTTGGACTCGAGTCCAAGGATGGAAATTAGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207479.1-1085s1c1
Sequence:CCGGCTGTGGAAGCTTTGCTCCTATCTCGAGATAGGAGCAAAGCTTCCACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207479
LOC400940 MISSION shRNA shRNA Plasmid DNA
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000167958    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207479.1-1575s1c1
Sequence:CCGGCCCATAGAATAATAGAGGGAACTCGAGTTCCCTCTATTATTCTATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172332    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207479.1-1108s1c1
Sequence:CCGGCCAAATGGGTTGACTCTGGATCTCGAGATCCAGAGTCAACCCATTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207479.1-1020s1c1
Sequence:CCGGCGGCTAATTTCCATCCTTGGACTCGAGTCCAAGGATGGAAATTAGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207479.1-1085s1c1
Sequence:CCGGCTGTGGAAGCTTTGCTCCTATCTCGAGATAGGAGCAAAGCTTCCACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207479
LOC400940 MISSION shRNA Lentiviral Transduction Particles
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000167958    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207479.1-1575s1c1
Sequence:CCGGCCCATAGAATAATAGAGGGAACTCGAGTTCCCTCTATTATTCTATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172332    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207479.1-1108s1c1
Sequence:CCGGCCAAATGGGTTGACTCTGGATCTCGAGATCCAGAGTCAACCCATTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207479.1-1020s1c1
Sequence:CCGGCGGCTAATTTCCATCCTTGGACTCGAGTCCAAGGATGGAAATTAGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207479.1-1085s1c1
Sequence:CCGGCTGTGGAAGCTTTGCTCCTATCTCGAGATAGGAGCAAAGCTTCCACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)